{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	add
Gene Synonym(s)	ECK1618, b1623, JW1615^[1], JW1615
Product Desc.	Adenosine deaminase; mutants affect growth on deoxyadenosine in purA, B mutants^[2]
Product Synonyms(s)	adenosine deaminase^[1], B1623^[3]^[1], Add^[3]^[1] , ECK1618, JW1615, b1623
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): add^[3]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

Adenosine deaminase is an enzyme involved in purine metabolism, which irreversibly deaminates both adenosine and deoxyadenosine to inosine and deoxyinosine. The optimal pH for this enzyme is around 7.5-8, but activity is irreversibly lost when pH is lower than 2.7 or higher than 9.5. Adenosine deaminase is sensitive to heavy metals, such as Ag+, Cu2+, and Cr3+, and reacts with them irreversibly (Koch, 1958). ^[4]

Complications in purine metabolism often result in various disorders in humans. Deficiencies amounts of adenosine deaminase result in diseases such as severe combined immunodeficiency disorder (SCID) and lymphopenia.

Binds TrxA (Kumar, 2004).^[2]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	add
Mnemonic	Adenosine deaminase
Synonyms	ECK1618, b1623, JW1615^[1], JW1615
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	36.65 minutes	MG1655: 1700257..1701258 <gbrowseImage> name=NC_000913:1700257..1701258 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 1679427..1680428 <gbrowseImage> name=NC_012967:1679427..1680428 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 1592316..1593317 <gbrowseImage> name=NC_012759:1592316..1593317 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 1703947..1704948 <gbrowseImage> name=NC_007779:1703947..1704948 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 1791218..1792219 <gbrowseImage> name=NC_010473:1791218..1792219 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Description	Reference	Availability	Comments
Δadd (Keio:JW1615)	deletion	deletion		PMID:16738554	Shigen CGSC9376^[5]
add-6					CGSC:7309
Δadd-771::kan				PMID:16738554	CGSC:99910
S Φ 3834			Tet resistant	PMID:1998686		rpsL, Δadd-uid-man, metB, guaA, uraA::TnlO
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW1615	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCATTGATACCACCCTGCCATT Primer 2:CCtTTCGCGGCGACTTTTTCTCG
6A5	Kohara Phage	Genobase	PMID:3038334
9A1	Kohara Phage	Genobase	PMID:3038334
20B5	Kohara Phage	Genobase	PMID:3038334
zdd-235::Tn10	Linked marker	CAG18461 = CGSC7378^[5]	est. P1 cotransduction: % ^[6] Synonyms:zdc-235::Tn10
zdi-925::Tn10	Linked marker	CAG12151 = CGSC7385^[5]	est. P1 cotransduction: 1% ^[6] Synonyms:zdh-925::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10030	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10030	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000027	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945851	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0029	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0005435	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	Add
Synonyms	adenosine deaminase^[1], B1623^[3]^[1], Add^[3]^[1] , ECK1618, JW1615, b1623
Product description	Adenosine deaminase; mutants affect growth on deoxyadenosine in purA, B mutants^[2]
EC number (for enzymes)	3.5.4.4^[1]
edit table

Notes

Adenosine deaminase is the enzyme that catalyzes the irreversible deamination of adenosine or deoxyadenosine to inosine or deoxyinosine. The active site of ADA contains residues of a Histidine, 2 Aspartic acids, one Glutamic acid, and a zinc atom. The overall mechanism involves a hydroxyl group addition to C6 of adenosine, which forms the tetrahedral transition state intermediate. Then, the ammonia elimination forms inosine. Zinc acts as a powerful electrophile, which allows a water molecule to attack C6. Glutamic acid interacts with N1 and donates a proton, reducing the N1=C6 double bond character, allowing the hydroxyl nucleophilic attack. A Histidine residue and the carboxylic group of aspartic acid stabilizes and orients the zinc-bound water molecule. The ammonia elimination pathway is not quite understood but is the final step in the mechanism of adenosine deaminase.

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005737	cytoplasm				C	Seeded from Riley et al 2006 ^[1].	Missing: evidence, reference
	GO:0004000	adenosine deaminase activity	PMID:4874315	IDA: Inferred from Direct Assay		F		complete
	GO:0004000	adenosine deaminase activity	PMID:765747	IMP: Inferred from Mutant Phenotype		F		complete
	GO:0015950	purine nucleotide interconversion	PMID:1998686	IGI: Inferred from Genetic Interaction	EcoliWiki:guaA	P		complete
	GO:0004000	adenosine deaminase activity	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00540	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009168	purine ribonucleoside monophosphate biosynthetic process	PMID:1998686	IGI: Inferred from Genetic Interaction	EcoliWiki:guaA	P		complete
	GO:0004000	adenosine deaminase activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006330	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005488	binding	PMID:3486673	ISS: Inferred from Sequence or Structural Similarity	UniProtKB:P56658	F	CHEBI:27834 (Deoxycoformycin mechanistically inhibits Add).	complete
	GO:0006154	adenosine catabolic process	PMID:1998686	IGI: Inferred from Genetic Interaction	EcoliWiki:guaA	P		complete
	GO:0004000	adenosine deaminase activity	GOA:spec GO_REF:0000003	IEA: Inferred from Electronic Annotation	EC:3.5.4.4	F	Seeded from EcoCyc (v14.0)	complete
	GO:0004000	adenosine deaminase activity	PMID:5335916	IDA: Inferred from Direct Assay		F		complete
	GO:0032261	purine nucleotide salvage	PMID:1998686	IGI: Inferred from Genetic Interaction	EcoliWiki:guaA	P		complete
	GO:0006154	adenosine catabolic process	PMID:1998686	IGI: Inferred from Genetic Interaction		P	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0043103	hypoxanthine salvage	PMID:1998686	IGI: Inferred from Genetic Interaction	EcoliWiki:guaA	P		complete
	GO:0009117	nucleotide metabolic process	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0546	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046101	hypoxanthine biosynthetic process	PMID:1998686	IGI: Inferred from Genetic Interaction	EcoliWiki:guaA	P		complete
	GO:0009168	purine ribonucleoside monophosphate biosynthetic process	GOA:hamap GO_REF:0000020	IEA: Inferred from Electronic Annotation	HAMAP:MF_00540	P	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	PMID:5335916	IC: Inferred by Curator		C		Missing: with/from
	GO:0009168	purine ribonucleoside monophosphate biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001365	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009168	purine ribonucleoside monophosphate biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006330	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009168	purine ribonucleoside monophosphate biosynthetic process	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR006650	P	Seeded from EcoCyc (v14.0)	complete
	GO:0009168	purine ribonucleoside monophosphate biosynthetic process	PMID:1998686	IGI: Inferred from Genetic Interaction		P	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0015950	purine nucleotide interconversion	PMID:1998686	IGI: Inferred from Genetic Interaction		P	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0032261	purine nucleotide salvage	PMID:1998686	IGI: Inferred from Genetic Interaction		P	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0043103	hypoxanthine salvage	PMID:1998686	IGI: Inferred from Genetic Interaction		P	Seeded from EcoCyc (v14.0)	Missing: with/from
	GO:0006974	response to DNA damage stimulus	PMID:11967071	IEP: Inferred from Expression Pattern		P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes	References	Evidence
Protein	rpsM		PMID:16606699	Experiment(s):EBI-1140315
Protein	arpA		PMID:16606699	Experiment(s):EBI-1140315
Protein	rplT		PMID:16606699	Experiment(s):EBI-1140315
Protein	insC1		PMID:16606699	Experiment(s):EBI-1140315
Protein	ligA		PMID:16606699	Experiment(s):EBI-1140315
Protein	gcd		PMID:16606699	Experiment(s):EBI-1140315
Small Molecule	CHEBI:27834 (Deoxycoformycin)	Inhibitor of Add activity
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MIDTTLPLTD IHRHLDGNIR PQTILELGRQ YNISLPAQSL ETLIPHVQVI ANEPDLVSFL TKLDWGVKVL ASLDACRRVA FENIEDAARH GLHYVELRFS PGYMAMAHQL PVAGVVEAVI DGVREGCRTF GVQAKLIGIM SRTFGEAACQ QELEAFLAHR DQITALDLAG DELGFPGSLF LSHFNRARDA GWHITVHAGE AAGPESIWQA IRELGAERIG HGVKAIEDRA LMDFLAEQQI GIESCLTSNI QTSTVAELAA HPLKTFLEHG IRASINTDDP GVQGVDIIHE YTVAAPAAGL SREQIRQAQI NGLEMAFLSA EEKRALREKV AAK
Length	333
Mol. Wt	36.397 kDa
pI	5.4 (calculated)
Extinction coefficient	22,460 - 22,960 (calc based on 4 Y, 3 W, and 4 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
Domain	5..329	PF00962 Adenosine/AMP deaminase		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=add taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16129581	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945851	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0005435	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P22333	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG10030	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10030	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945851	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000027	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0029	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	2.89E+02	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	724	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	265	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	548	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
add
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:1700237..1700277 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b1623 (EcoliWiki Page)	NCBI GEO profiles for add
microarray	GenExpDB:b1623 (EcoliWiki Page)	Summary of data for add from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (1700057..1700309) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ05; Well:A8^[7]
edit table

Notes

Accessions Related to add Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG10030	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0029	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b1623
EcoGene	EcoGene:EG10030	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000027	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0005435	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000015635 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Apis mellifera	ENSAPMP00000027171 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Arabidopsis thaliana	AT4G04880 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Bos taurus	ENSBTAP00000006947 (score: 1.000; bootstrap: 69%)	From Inparanoid:20070104
Caenorhabditis briggsae	WBGene00028141 (score: 1.000; bootstrap: 100%) WBGene00028142 (score: 0.750)	From Inparanoid:20070104
Caenorhabditis elegans	WBGene00015551 (score: 1.000; bootstrap: 97%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000013968 (score: 1.000; bootstrap: 90%)	From Inparanoid:20070104
Ciona intestinalis	ENSCINP00000004062 (score: 1.000; bootstrap: 99%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-040718-393 (score: 1.000; bootstrap: 93%) ZDB-CDNA-040718-431 (score: 1.000; bootstrap: 93%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0230171 (score: 1.000; bootstrap: 99%)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0037661 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Drosophila pseudoobscura	GA11319-PA (score: 1.000; bootstrap: 78%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000006620 (score: 1.000; bootstrap: 92%)	From Inparanoid:20070104
Homo sapiens	ENSP00000352331 (score: 1.000; bootstrap: 94%)	From Inparanoid:20070104
Macaca mulatta	ENSMMUP00000013898 (score: 1.000; bootstrap: 86%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000020255 (score: 1.000; bootstrap: 90%)	From Inparanoid:20070104
Mus musculus	MGI:87916 (score: 1.000; bootstrap: 96%)	From Inparanoid:20070104
Pan troglodytes	ENSPTRP00000023233 (score: 1.000; bootstrap: 94%)	From Inparanoid:20070104
Rattus norvegicus	ENSRNOP00000014151 (score: 1.000; bootstrap: 95%)	From Inparanoid:20070104
Saccharomyces cerevisiae	YNL141W (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPBC11982 (score: 1.000; bootstrap: 100%) SPBC16832 (score: 0.159)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000132496 (score: 1.000; bootstrap: 89%)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00023391001 (score: 1.000; bootstrap: 84%) GSTENP00003273001 (score: 0.056)	From Inparanoid:20070104
Xenopus tropicalis	ENSXETP00000007489 (score: 1.000; bootstrap: 52%) ENSXETP00000007493 (score: 0.561)	From Inparanoid:20070104
Shigella flexneri	ADD	From SHIGELLACYC
E. coli O157	ADD	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00962 Adenosine/AMP deaminase
Superfamily (EcoliWiki Page)	SUPERFAMILY:51556
Panther (EcoliWiki Page)	PTHR11409:SF21
EcoCyc	EcoCyc:EG10030	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG10030	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120000027	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB0029	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0005435	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ KOCH, AL & VALLEE, G (1959) The properties of adenosine deaminase and adenosine nucleoside phosphorylase in extracts of Escherichia coli. J. Biol. Chem. 234 1213-8 PubMed
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

add:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to add Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search