acnB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
acnB |
|---|---|
| Mnemonic |
Aconitase |
| Synonyms |
ECK0117, b0118, JW0114, yacI, yacJ[1], yacJ |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.84 minutes |
MG1655: 131615..134212 |
||
|
NC_012967: 134419..137016 |
||||
|
NC_012759: 131614..134211 |
||||
|
W3110 |
|
W3110: 131615..134212 |
||
|
DH10B: 105719..108316 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
131615 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
acnB(del) (Keio:JW0114) |
deletion |
deletion |
|||||
|
acnB(del)::kan |
deletion |
Biolog:respiration |
unable to respire Bromosuccinate |
||||
|
acnB(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Asparagine |
||||
|
acnB(del)::kan |
deletion |
Biolog:respiration |
unable to respire L-Aspartate |
||||
|
acnB(del)::tetR |
Internal deletion of acnB replaced with tetR gene. |
Growth Phenotype |
Cannot grow on acetate as the sole carbon and energy source with or without supplementation with glutamate. |
||||
|
acnB(del)::tetR |
Internal deletion of acnB substituted with tetR. |
Growth Phenotype |
Grows poorly on minimal glucose medium unless the medium is supplemented with glutamate. The same phenotype is seen for growth on minimal medium with glycerol, lactate, pyruvate, or succinate as the carbon and energy source. |
Mutants lacking citrate synthase (gltA) or isocitrate dehydrogenase (icd) are glutamate auxotrophs. The mutant lacking acnB doesn't have an absolutely requirement for glutamate because of the second aconitase activity (acnA). | |||
|
acnB736(del)::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0114 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCTAGAAGAATACCGTAAGCA Primer 2:CCAACCGCAGTCTGGAAAATCAC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 11% [10] | |
|
Linked marker |
est. P1 cotransduction: 55% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Bradbury, AJ et al. (1996) The second aconitase (AcnB) of Escherichia coli. Microbiology (Reading, Engl.) 142 ( Pt 2) 389-400 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 6.2 Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ 7.0 7.1 Gruer, MJ et al. (1997) Construction and properties of aconitase mutants of Escherichia coli. Microbiology (Reading, Engl.) 143 ( Pt 6) 1837-46 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
