dedD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dedD |
|---|---|
| Mnemonic |
Downstream E. coli DNA |
| Synonyms |
ECK2308, b2314, JW5378[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
52.35 minutes |
MG1655: 2429706..2429044 |
||
|
NC_012967: 2375276..2374614 |
||||
|
W3110 |
|
W3110: 2437130..2436468 |
||
|
DH10B: 2521471..2520809 |
||||
|
NC_012759: 2314849..2315511 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔdedD (Keio:JW5378) |
deletion |
deletion |
|||||
|
At position 407 in Plus orientation, contains plasmid pKD46. | |||||||
|
ΔdedD::kan |
deletion |
Biolog:respiration |
unable to respire Acetate |
| |||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5378 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAAGTAAGTTTCAGAATCG Primer 2:CCATTCGGCGTATAGCCCATTAC | |
|
Linked marker |
est. P1 cotransduction: 19% [7] | ||
|
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: 3% [7] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).