dnaX:Gene: Difference between revisions
imported>Wikientrybot Move help links into the <above> tag inside templates. |
BatchPageAppend.php edit. |
||
| Line 416: | Line 416: | ||
[[Category:Genes not in the Keio knockout collection]] | [[Category:Genes not in the Keio knockout collection]] | ||
[[Category:Genes in the ASKA clone collection]] | [[Category:Genes in the ASKA clone collection]] | ||
[[Category:dna genes]] | [[Category:dna genes]][[Category:Gene_List:DH10B]] | ||
Revision as of 15:13, 6 April 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaX |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0464, b0470, JW0459, dnaZ[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
10.59 minutes |
MG1655: 491316..493247 |
||
|
W3110 |
|
W3110: 491316..493247 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dnaX36 |
E601K |
Growth Phenotype |
ts growth. Fast stop DNA replication arrest at 44° |
Affects Tau but not Gamma | |||
|
dnaX36 |
Other |
Weak mutator in mismatch repair deficient strain |
|||||
|
dnaX0 |
|||||||
|
dnaX2016 |
|||||||
|
dnaX36(ts) |
temperature sensitive |
||||||
|
dnaXE145A |
E145A |
failure to suppress parE10 when overexpressed |
| ||||
| edit table |
Notes
The dnaX locus was identified by the J, Walker lab[5] as the site of one of several ts mutations in strain SG133, which was originally thought to contain a single mutation in dnaZ[6].
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0459 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTTATCAGGTCTTAGCCCG Primer 2:CCAATGGGGCGGATACTTTCTTC | |
|
Linked marker |
est. P1 cotransduction: 28% [9] | ||
|
Linked marker |
est. P1 cotransduction: 72% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Pham, PT et al. (2006) Mutator mutants of Escherichia coli carrying a defect in the DNA polymerase III tau subunit. Mol. Microbiol. 59 1149-61 PubMed
- ↑ Blinkova, A et al. (1993) The Escherichia coli DNA polymerase III holoenzyme contains both products of the dnaX gene, tau and gamma, but only tau is essential. J. Bacteriol. 175 6018-27 PubMed
- ↑ Espeli, O et al. (2003) Temporal regulation of topoisomerase IV activity in E. coli. Mol. Cell 11 189-201 PubMed
- ↑ Henson, JM et al. (1979) Isolation and characterization of dnaX and dnaY temperature-sensitive mutants of Escherichia coli. Genetics 92 1041-59 PubMed
- ↑ Sevastopoulos, CG et al. (1977) Large-scale automated isolation of Escherichia coli mutants with thermosensitive DNA replication. Proc. Natl. Acad. Sci. U.S.A. 74 3485-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).