secA:Gene: Difference between revisions
Edited by wikibot |
Fixing Gbrowse links (bug #119) |
||
| Line 84: | Line 84: | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10936 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10936 EcoCyc] | ||
{{GBrowseLink| | {{GBrowseLink|MG1655|NC_000913|107279|111984|GBrowse(MG1655)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|MG1655|NC_000913|108279|110984|FASTA Dump}} | ||
*[http://biocyc.org/ECOLI/sequence?object=EG10936 EcoCyc Sequence Dump] | *[http://biocyc.org/ECOLI/sequence?object=EG10936 EcoCyc Sequence Dump] | ||
|- | |- | ||
| Line 118: | Line 118: | ||
| | | | ||
{{GBrowseLink|BW2952| | {{GBrowseLink|BW2952|NC_012759|108278|110983|GBrowse (BW2952)}} | ||
| | | | ||
{{GBrowseFastaLink|BW2952| | {{GBrowseFastaLink|BW2952|NC_012759|108278|110983|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 134: | Line 134: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|W3110|AC_000091|107279|111984|GBrowse(W3110)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|W3110|AC_000091|108279|110984|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 150: | Line 150: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|DH10B|NC_010473|76973|90498|GBrowse(DH10B)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|DH10B|NC_010473|76973|90498|FASTA Dump}} | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 20:25, 17 August 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
secA |
|---|---|
| Mnemonic |
Secretory |
| Synonyms |
ECK0099, b0098, JW0096, azi, pea, prlD[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.33 minutes |
MG1655: 108279..110984 |
||
|
NC_012967: 111083..113788 |
||||
|
NC_012759: 108278..110983 |
||||
|
W3110 |
|
W3110: 108279..110984 |
||
|
DH10B: 82383..85088 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
108279 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
secA207(aziR) |
azide resistant |
||||||
|
secA206(aziR) |
azide resistant |
||||||
|
secA214(aziR) |
azide resistant |
||||||
|
secA215 |
|||||||
|
secA204(aziR) |
azide resistant |
||||||
|
secA209(aziR) |
azide resistant |
||||||
|
secA216 |
|||||||
|
secA201(aziR) |
azide resistant |
||||||
|
secA202(aziR) |
azide resistant |
||||||
|
secA203(aziR) |
azide resistant |
||||||
|
secA205(aziR) |
azide resistant |
||||||
|
secA51(ts) |
temperature sensitive |
| |||||
| edit table |
Notes
SecA mutants were first identified by Oliver and Beckwith[4] by looking for suppressors of the Lac- phenotype of a maE-lacZ fusion. The original secA alleles were ts lethals.
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0096 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCTAATCAAATTGTTAACTAA Primer 2:CCTTGCAGGCGGCCATGGCACTG | |
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 39% [7] | |
|
Linked marker |
est. P1 cotransduction: 18% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Schmidt, MG et al. (1988) Nucleotide sequence of the secA gene and secA(Ts) mutations preventing protein export in Escherichia coli. J. Bacteriol. 170 3404-14 PubMed
- ↑ Danese, PN et al. (1995) Multicopy suppression of cold-sensitive sec mutations in Escherichia coli. J. Bacteriol. 177 4969-73 PubMed
- ↑ Oliver, DB & Beckwith, J (1981) E. coli mutant pleiotropically defective in the export of secreted proteins. Cell 25 765-72 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).