mutL:Gene: Difference between revisions
Table edited by Joncrz via TableEdit |
Fixing Gbrowse links (bug #119) |
||
| Line 84: | Line 84: | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG11281 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG11281 EcoCyc] | ||
{{GBrowseLink| | {{GBrowseLink|MG1655|NC_000913|4394435|4398282|GBrowse(MG1655)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|MG1655|NC_000913|4395435|4397282|FASTA Dump}} | ||
*[http://biocyc.org/ECOLI/sequence?object=EG11281 EcoCyc Sequence Dump] | *[http://biocyc.org/ECOLI/sequence?object=EG11281 EcoCyc Sequence Dump] | ||
|- | |- | ||
| Line 118: | Line 118: | ||
| | | | ||
{{GBrowseLink|BW2952| | {{GBrowseLink|BW2952|NC_012759|4334170|4336017|GBrowse (BW2952)}} | ||
| | | | ||
{{GBrowseFastaLink|BW2952| | {{GBrowseFastaLink|BW2952|NC_012759|4334170|4336017|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 134: | Line 134: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|W3110|AC_000091|4401092|4404939|GBrowse(W3110)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|W3110|AC_000091|4402092|4403939|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 150: | Line 150: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|DH10B|NC_010473|4492103|4501338|GBrowse(DH10B)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|DH10B|NC_010473|4492103|4501338|FASTA Dump}} | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 20:12, 17 August 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mutL |
|---|---|
| Mnemonic |
Mutator |
| Synonyms |
ECK4166, b4170, JW4128[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
94.74 minutes |
MG1655: 4395435..4397282 |
||
|
NC_012967: 4375567..4377414 |
||||
|
NC_012759: 4334170..4336017 |
||||
|
W3110 |
|
W3110: 4402092..4403939 |
||
|
DH10B: 4495797..4497644 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔmutL (Keio:JW4128) |
deletion |
deletion |
|||||
|
mutL218::Tn10 |
|||||||
|
mutL13 |
|||||||
|
ΔmutL720::kan |
|||||||
|
mutL::KmMlu |
GC To AT and AT to GC transition Mutation |
Mutation Frequency |
Insertion caused GC to AT and AT to GC transition mutation to increase. Table 2. |
Strain: NU1521 (AT to GC) Strain: NU1509 (GC to AT) | |||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4128 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCCAATTCAGGTCTTACCGCC Primer 2:CCtTCATCTTTCAGGGCTTTTAT | |
|
Linked marker |
est. P1 cotransduction: 20% [7] | ||
|
Linked marker |
est. P1 cotransduction: 30% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Liberfarb, RM & Bryson, V (1970) Isolation, characterization, and genetic analysis of mutator genes in Escherichia coli B and K-12. J. Bacteriol. 104 363-75 PubMed
- ↑ Connolly, DM & Winkler, ME (1991) Structure of Escherichia coli K-12 miaA and characterization of the mutator phenotype caused by miaA insertion mutations. J. Bacteriol. 173 1711-21 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).