mutL:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mutL |
|---|---|
| Mnemonic |
Mutator |
| Synonyms |
ECK4166, b4170, JW4128[1], JW4128 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
94.74 minutes |
MG1655: 4395435..4397282 |
||
|
NC_012967: 4375567..4377414 |
||||
|
NC_012759: 4334170..4336017 |
||||
|
W3110 |
|
W3110: 4402092..4403939 |
||
|
DH10B: 4495797..4497644 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mutL(del) (Keio:JW4128) |
deletion |
deletion |
|||||
|
mutL218::Tn10 |
|||||||
|
mutL13 |
|||||||
|
mutL720(del)::kan |
|||||||
|
mutL::KmMlu |
GC To AT and AT to GC transition Mutation |
Mutation Frequency |
Insertion caused GC to AT and AT to GC transition mutation to increase. Table 2. |
Strain: NU1521 (AT to GC) Strain: NU1509 (GC to AT) | |||
|
mutL:omega(Kmr OR Cmr);BsaAI |
Auxotrophies |
The polar omega cassettes blocked mutL-miaA transcription and caused the full-lengthened protected species to disappear, Fig. 2 lanes 3 and 4. |
Strains: TX2568 (Cmr) & TX2569 (Kmr) | ||||
|
MutL(del)335N |
deletion of N terminus |
excision activity |
Truncation mutant was inefficient as wild type MutL in promoting the excision activity of ExoX. Interaction between MutL and ExoX was also reduced. figure 4. These data suggest that the 335 N-terminal amoni acids of MutL are essential for both the interaction and stimulation of ExoX. |
||||
|
MutL-E29A |
replacement of Glutamic acid to Alanine at position 29. |
DNA repair |
mutant form of MutL is inactive in ATP hydrolysis but still has a physical interaction with RecA. Mutation had an inhibitory effect on RecA's ATPase activity, Figure 4B. |
Parent Strain:MG1655 |
| ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4128 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCCAATTCAGGTCTTACCGCC Primer 2:CCtTCATCTTTCAGGGCTTTTAT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 20% [11] | ||
|
Linked marker |
est. P1 cotransduction: 30% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Liberfarb, RM & Bryson, V (1970) Isolation, characterization, and genetic analysis of mutator genes in Escherichia coli B and K-12. J. Bacteriol. 104 363-75 PubMed
- ↑ Connolly, DM & Winkler, ME (1991) Structure of Escherichia coli K-12 miaA and characterization of the mutator phenotype caused by miaA insertion mutations. J. Bacteriol. 173 1711-21 PubMed
- ↑ Tsui, HC & Winkler, ME (1994) Transcriptional patterns of the mutL-miaA superoperon of Escherichia coli K-12 suggest a model for posttranscriptional regulation. Biochimie 76 1168-77 PubMed
- ↑ Cheng, F et al. (2010) Functional interaction between MutL and 3'-5' exonuclease X in Escherichia coli. Arch. Biochem. Biophys. 502 39-43 PubMed
- ↑ Zhang, M et al. (2012) MutL associates with Escherichia coli RecA and inhibits its ATPase activity. Arch. Biochem. Biophys. 517 98-103 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).