hemX:Gene: Difference between revisions
Edited by wikibot |
Fixing Gbrowse links (bug #119) |
||
| Line 84: | Line 84: | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10433 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10433 EcoCyc] | ||
{{GBrowseLink| | {{GBrowseLink|MG1655|NC_000913|3984908|3988089|GBrowse(MG1655)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|MG1655|NC_000913|3985908|3987089|FASTA Dump}} | ||
*[http://biocyc.org/ECOLI/sequence?object=EG10433 EcoCyc Sequence Dump] | *[http://biocyc.org/ECOLI/sequence?object=EG10433 EcoCyc Sequence Dump] | ||
|- | |- | ||
| Line 118: | Line 118: | ||
| | | | ||
{{GBrowseLink|BW2952| | {{GBrowseLink|BW2952|NC_012759|3875577|3876758|GBrowse (BW2952)}} | ||
| | | | ||
{{GBrowseFastaLink|BW2952| | {{GBrowseFastaLink|BW2952|NC_012759|3875577|3876758|FASTA Dump}} | ||
|- | |- | ||
| | | | ||
| Line 134: | Line 134: | ||
| | | | ||
{{GBrowseLink| | {{GBrowseLink|W3110|AC_000091|3646615|3649796|GBrowse(W3110)}} | ||
| | | | ||
{{GBrowseFastaLink| | {{GBrowseFastaLink|W3110|AC_000091|3647615|3648796|FASTA Dump}} | ||
|- class="tableEdit_footer" | |- class="tableEdit_footer" | ||
Revision as of 20:03, 17 August 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
hemX |
|---|---|
| Mnemonic |
Hemin |
| Synonyms |
ECK3797, b3803, JW3775[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
85.91 minutes |
MG1655: 3987089..3985908 |
||
|
NC_012967: 3950896..3949691 |
||||
|
NC_012759: 3875577..3876758 |
||||
|
W3110 |
|
W3110: 3647615..3648796 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3985908 |
Edman degradation |
| ||
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
D318N |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
ΔhemX (Keio:JW3775) |
deletion |
deletion |
|||||
|
hemX::Tn5KAN-I-SceI (FB21463) |
Insertion at nt 693 in Minus orientation |
contains pKD46 | |||||
|
ΔhemX750::kan |
| ||||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3775 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACGGAACAAGAAAAAACCTC Primer 2:CCTTCTCCTTGCGGCGCGGCTGC | |
|
Linked marker |
est. P1 cotransduction: 27% [8] | ||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 43% [8] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).