glcF:Gene: Difference between revisions
Adding section & Genetic interactions table to Gene pages. |
Edited by wikibot |
||
| Line 78: | Line 78: | ||
MG1655: 3123481..3122258<br /><gbrowseImage> | MG1655: 3123481..3122258<br /><gbrowseImage> | ||
name=NC_000913:3122258..3123481 | name=NC_000913:3122258..3123481 | ||
source= | source=MG1655 | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
| Line 129: | Line 129: | ||
W3110: 3124115..3122892<br /><gbrowseImage> | W3110: 3124115..3122892<br /><gbrowseImage> | ||
name=AC_000091:3122892..3124115 | name=AC_000091:3122892..3124115 | ||
source= | source=MG1655_W3110 | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
| Line 145: | Line 145: | ||
DH10B: 3221226..3220003<br /><gbrowseImage> | DH10B: 3221226..3220003<br /><gbrowseImage> | ||
name=NC_010473:3220003..3221226 | name=NC_010473:3220003..3221226 | ||
source= | source=MG1655_DH10B | ||
preset=GeneLocation | preset=GeneLocation | ||
</gbrowseImage> | </gbrowseImage> | ||
Revision as of 22:38, 24 June 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
glcF |
|---|---|
| Mnemonic |
Glycolate |
| Synonyms |
ECK2972, b4467, JW5486, b2978, yghL, gox, b2978 (obsolete)[1][2] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
67.29 minutes |
MG1655: 3123481..3122258 |
||
|
NC_012967: 3052351..3051128 |
||||
|
NC_012759: 3009406..3010629 |
||||
|
W3110 |
|
W3110: 3124115..3122892 |
||
|
DH10B: 3221226..3220003 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔglcF (Keio:JW5486) |
deletion |
deletion |
| ||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5486 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCAAACCCAATTAACTGAAGA Primer 2:CCTTCCTTTTCAAGGGCTTGTTC | |
|
Linked marker |
est. P1 cotransduction: 52% [6] | ||
|
Linked marker |
est. P1 cotransduction: 34% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).