lexA:Gene: Difference between revisions
/Volumes/r3/t3/ul/working/touchTables/touch_all_tables.php |
Insert SeqFeature_Table link. |
||
| Line 14: | Line 14: | ||
|{{Sub}}[[#Nomenclature |Nomenclature]] | |{{Sub}}[[#Nomenclature |Nomenclature]] | ||
|{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]] | |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]] | ||
|{{Sub}}[[#Sequence Features|Sequence Features]] | |||
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]] | |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]] | ||
|{{Sub}}[[#Genetic Resources |Genetic Resources]] | |{{Sub}}[[#Genetic Resources |Genetic Resources]] | ||
Revision as of 23:09, 10 May 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lexA |
|---|---|
| Mnemonic |
Lambda excision |
| Synonyms |
ECK4035, b4043, JW4003, exrA, tsl, umuA[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
91.71 minutes |
MG1655: 4255138..4255746 |
||
|
NC_012967: 4236047..4236655 |
||||
|
NC_012759: 4193983..4194591 |
||||
|
W3110 |
|
W3110: 4260705..4261313 |
||
|
DH10B: 4354834..4355442 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
spr |
uninducible, not cleaved during SOS response | ||||||
|
lexAG85D |
G85D |
(in lexA3, resistant to cleavage) |
Strain variation; seeded from UniProt:P0A7C2 | ||||
|
lexA107 |
|||||||
|
lexA1(Ind-) |
non-inducible SOS response |
||||||
|
lexA41(ts) |
temperature sensitive |
||||||
|
lexA3(Ind-) |
non-inducible SOS response |
||||||
|
lexA51 |
|||||||
|
lexA101 |
|||||||
|
lexA102 |
|||||||
|
lexA109 |
|||||||
|
lexA103 |
|||||||
|
lexA104 |
|||||||
|
lexA105 |
|||||||
|
lexA106 |
|||||||
|
lexA108 |
|||||||
|
lexA71::Tn5 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4003 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAGCGTTAACGGCCAGGCA Primer 2:CCaAGCCAGTCGCCGTTGCGAAT | |
|
Linked marker |
est. P1 cotransduction: 60% [6] | ||
|
Linked marker |
est. P1 cotransduction: 9% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Lin, LL & Little, JW (1988) Isolation and characterization of noncleavable (Ind-) mutants of the LexA repressor of Escherichia coli K-12. J. Bacteriol. 170 2163-73 PubMed
- ↑ Froehlich, B (1981) Weigle reactivation of the single-stranded DNA phage f1. Mol. Gen. Genet. 184 416-20 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).