mutM:Gene: Difference between revisions
Fixing references section. |
Fixing zoom on GBrowse image. |
||
| Line 74: | Line 74: | ||
82.08 minutes | 82.08 minutes | ||
| | | | ||
MG1655: 3809175..3808366<br />{{GBrowseFigureByCoord| | MG1655: 3809175..3808366<br />{{GBrowseFigureByCoord|3808366|3809175|ecoli|MG1655}} | ||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10329 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10329 EcoCyc] | ||
| Line 88: | Line 88: | ||
| | ||
| | | | ||
W3110: 3829263..3830072<br />{{GBrowseFigureByCoord| | W3110: 3829263..3830072<br />{{GBrowseFigureByCoord|3829263|3830072|ecoli_W3110|W3110}} | ||
| | | | ||
{{GBrowseLink|ecoli_W3110|AC_000091|3828263|3831072|GBrowse(W3110)}} | {{GBrowseLink|ecoli_W3110|AC_000091|3828263|3831072|GBrowse(W3110)}} | ||
| Line 99: | Line 99: | ||
| | | | ||
DH10B: 3906752..3905943<br />{{GBrowseFigureByCoord| | DH10B: 3906752..3905943<br />{{GBrowseFigureByCoord|3905943|3906752|ecoli_DH10B|DH10B}} | ||
| | | | ||
{{GBrowseLink|ecoli_DH10B|NC_010473|3904325|3908370|GBrowse(DH10B)}} | {{GBrowseLink|ecoli_DH10B|NC_010473|3904325|3908370|GBrowse(DH10B)}} | ||
Revision as of 23:43, 12 December 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mutM |
|---|---|
| Mnemonic | |
| Synonyms |
ECK3625, b3635, JW3610, fpg[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
82.08 minutes |
MG1655: 3809175..3808366 |
||
|
W3110 |
|
W3110: 3829263..3830072 |
||
|
DH10B: 3906752..3905943 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔmutM (Keio:JW3610) |
deletion |
deletion |
|||||
|
At position 312 in Plus orientation, contains plasmid pKD46. | |||||||
|
At position 312 in Plus orientation, does not contain plasmid pKD46. | |||||||
|
mutM102::kan |
|||||||
|
mutM103::mini-Tn10 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3610 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCCTGAATTACCCGAAGTTGA Primer 2:CCtTTCTGGCACTGCCGACAATA | |
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [7] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: 50% [7] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 Glasner, JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res. 31 147-51 PubMed
- ↑ 4.0 4.1 Bridges, BA et al. (1996) Effect of mutY and mutM/fpg-1 mutations on starvation-associated mutation in Escherichia coli: implications for the role of 7,8-dihydro-8-oxoguanine. Mol. Gen. Genet. 251 352-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).