mutH:Gene: Difference between revisions
Edited by wikibot |
Data loaded by TableEdit_Loader. |
||
| Line 126: | Line 126: | ||
<!-- | <!-- | ||
****************************************************************************************** | ****************************************************************************************** | ||
* | * | ||
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | ||
* | * | ||
****************************************************************************************** --> | ****************************************************************************************** --> | ||
{|class = 'sortable' {{Prettytable}} | {|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}} | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments | ||
|- | |- | ||
| | | | ||
ΔmutH (Keio:JW2799) | ΔmutH (Keio:JW2799) | ||
| Line 147: | Line 147: | ||
[[PMID:16738554]]<ref name=PMID:16738554/> | [[PMID:16738554]]<ref name=PMID:16738554/> | ||
| | | | ||
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=108467 CGSC10186]<ref name='LIB:cgsc'/> | [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=108467 CGSC10186]<ref name='LIB:cgsc'/> | ||
| | | | ||
|- | |||
| | |||
''mutH34'' | |||
| | |||
| | |||
| | |||
| | |||
| | |||
[[PMID:1092652]]<ref name=PMID:1092652/> | |||
| | |||
[[cgscmutation:12133|CGSC:12133]] | |||
| | |||
|-class='sortbottom' | |-class='sortbottom' | ||
|[{{SERVER}}{{SCRIPTPATH}} | |[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.16229.F46a9e754a3b82&page=16229&pagename={{FULLPAGENAMEE}}&type=&template=Gene_allele_table edit table] || || || || || || || | ||
|} | |} | ||
<!--box uid=421aa90e079fa326b6494f812ad13e79.16229.F46a9e754a3b82--> | <!--box uid=421aa90e079fa326b6494f812ad13e79.16229.F46a9e754a3b82--> | ||
Revision as of 15:30, 21 August 2008
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
mutH |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2827, b2831, JW2799, mutR, prv[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.96 minutes |
MG1655: 2967684..2968373 |
||
|
W3110 |
|
W3110: 2968318..2969007 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔmutH (Keio:JW2799) |
deletion |
deletion |
|||||
|
mutH34 |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2799 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCCCAACCTCGCCCACTGCT Primer 2:CCtTGGATCAGAAAATGACGGGC | |
|
Linked marker |
est. P1 cotransduction: 55% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] Synonyms:zgd-210::Tn10, zgf-210::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Hoess, RH & Herman, RK (1975) Isolation and characterization of mutator strains of Escherichia coli K-12. J. Bacteriol. 122 474-84 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).