yrhC:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
yrhC |
---|---|
Gene Synonym(s) |
ECK3468, b4552, JW5678[1], JW5678 |
Product Desc. | |
Product Synonyms(s) |
, ECK3468, JW5678, b4552 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
yrhC |
---|---|
Mnemonic | |
Synonyms |
ECK3468, b4552, JW5678[1], JW5678 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
78.06 minutes, 78.06 minutes |
MG1655: 3621910..3622155 |
||
W3110 |
|
W3110: 4016528..4016283 |
||
DH10B: 3719655..3719900 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔyrhC (Keio:JW5678) |
deletion |
deletion |
PMID:16738554 |
||||
ΔyrhC738::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW5678 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCTCAAATACATACCAGAAAAG Primer 2:CCTATTTGCCCGAGTATAAATGC | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: 30% [3] | |
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: % [3] | |
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc: |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120026454 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE: |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
<protect> See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name | |
---|---|
Synonyms |
, ECK3468, JW5678, b4552 |
Product description | |
EC number (for enzymes) |
|
edit table |
</protect>
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki. <protect></protect>
Notes
Function
<protect>
Gene Ontology
<protect>
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
edit table |
</protect>
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Interactions <protect> See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
edit table |
</protect>
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki. </protect>
Notes
Localization
<protect> See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
edit table |
</protect>
See Help:Product_localization for how to add or edit information in this section of EcoliWiki. <protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
<protect>
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name |
---|
Sequence |
Length |
Mol. Wt |
pI |
Extinction coefficient |
edit table |
</protect>
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Domains/Motifs/Modification Sites
<protect>
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
</protect> See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki. |
<motif_map/> |
Structure
</protect> See Help:Product_structure for help entering or editing information in this section of EcoliWiki. | </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
<protect>
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
</protect>
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki. <protect></protect>
Notes
Accessions in Other Databases
<protect>
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc: |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120026454 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
</protect>
See Help:Product_accessions for help entering or editing information in this section of EcoliWiki. <protect></protect>
Notes
Links
<protect>
Name | URL | Comments |
---|---|---|
edit table |
</protect>
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3621890..3621930
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to yrhC Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoGene: |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120026454 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE: |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP: |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
{{{EVOLUTION_HOMOLOGS_TABLE}}}
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Do-It-Yourself Web Tools
<protect></protect>
Notes
{{{HOMOLOGY_NOTES}}}
Families
{{{EVOLUTION_FAMILIES_TABLE}}}
See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.
<protect></protect>
Notes
{{{FAMILIES_NOTES}}}
Links
{{{LINKS}}}
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 CGSC: The Coli Genetics Stock Center
- ↑ 3.0 3.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories
{{{CATEGORIES}}}