ymjA:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

ymjA

Gene Synonym(s)

ECK1290, b1295, JW1288[1], JW1288

Product Desc.

predicted protein[2][3]

Function unknown[4]

Product Synonyms(s)

predicted protein[1], YmjA[2][1], B1295[2][1] , ECK1290, JW1288, b1295

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): ymjA[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ymjA

Mnemonic

Systematic nomenclature

Synonyms

ECK1290, b1295, JW1288[1], JW1288

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

29.21 minutes 

MG1655: 1355692..1355447
<gbrowseImage> name=NC_000913:1355447..1355692 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 1356036..1355791
<gbrowseImage> name=NC_012967:1355791..1356036 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 1246296..1246541
<gbrowseImage> name=NC_012759:1246296..1246541 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 1359382..1359137
<gbrowseImage> name=NC_007779:1359137..1359382 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 1445088..1444843
<gbrowseImage> name=NC_010473:1444843..1445088 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔymjA (Keio:JW1288)

deletion

deletion

PMID:16738554

Shigen
CGSC9157[5]

ΔymjA731::kan

PMID:16738554

CGSC:105760


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1288

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAACCACGATATCCCGCTAAA

Primer 2:CCtTCATTACCCCATTGATTCAA

E14F6

Kohara Phage

Genobase

PMID:3038334

1C2

Kohara Phage

Genobase

PMID:3038334

trpC83::Tn10

Linked marker

CAG18455 = CGSC7371[5]

est. P1 cotransduction: 21% [6]
Synonyms:trpB83::Tn10

zcj-233::Tn10

Linked marker

CAG12028 = CGSC7373[5]

est. P1 cotransduction: 63% [6]
Synonyms:zci-233::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G6642

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14295

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003237

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945874

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4043

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004359

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

YmjA

Synonyms

predicted protein[1], YmjA[2][1], B1295[2][1] , ECK1290, JW1288, b1295

Product description

predicted protein[2][3]

Function unknown[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

iscS

PMID:16606699

Experiment(s):EBI-1139487

Protein

galF

PMID:16606699

Experiment(s):EBI-1139487

Protein

rpsB

PMID:16606699

Experiment(s):EBI-1139487

Protein

nuoE

PMID:16606699

Experiment(s):EBI-1139487

Protein

rpsC

PMID:16606699

Experiment(s):EBI-1139487

Protein

nadE

PMID:16606699

Experiment(s):EBI-1139487

Protein

rpsG

PMID:16606699

Experiment(s):EBI-1139487

Protein

phnN

PMID:16606699

Experiment(s):EBI-1139487

Protein

slyD

PMID:16606699

Experiment(s):EBI-1139487

Protein

rpsD

PMID:16606699

Experiment(s):EBI-1139487

Protein

rplB

PMID:16606699

Experiment(s):EBI-1139487

Protein

ulaF

PMID:16606699

Experiment(s):EBI-1139487

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MNHDIPLKYF DIADEYATEC AEPVAEAERT PLAHYFQLLL TRLMNNEEIS EEAQHEMAAE
AGINPVRIDE IAEFLNQWGN E
Length

81

Mol. Wt

9.32 kDa

pI

4.0 (calculated)

Extinction coefficient

9,970 - 10,095 (calc based on 3 Y, 1 W, and 1 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

1..81

PF10820 Protein of unknown function (DUF2543)

PMID:19920124

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ymjA taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129256

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945874

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004359

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0ACV8

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G6642

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14295

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945874

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003237

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4043

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MC4100

3.68E+02

molecules/cell

  • Medium: median data from rich and minimal media
  • Temperature (°C): 37
  • Doubling time (min): Growth Rate(min):
  • Growth phase: other:

emPAI

PMID:18304323

Protein

Ecoli K-12

39.293+/-0.376

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.018367347

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

435

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

271

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

332

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

ymjA

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:1355672..1355712 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1295 (EcoliWiki Page)

NCBI GEO profiles for ymjA

microarray

GenExpDB:b1295 (EcoliWiki Page)

Summary of data for ymjA from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (1355601..1355860) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ16; Well:B3[7]

<protect></protect>

Notes

Accessions Related to ymjA Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G6642

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4043

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1295

EcoGene

EcoGene:EG14295

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003237

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004359

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]



Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

E. coli O157

YMJA

From ECOO157CYC

<protect></protect>

Notes

Families

[back to top]


<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database Accession Notes

Pfam (EcoliWiki Page)

PF10820 Protein of unknown function (DUF2543)


</protect> <protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]