ygdI:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
ygdI |
|---|---|
| Gene Synonym(s) |
ECK2805, b2809, JW5448[1], JW5448 |
| Product Desc. |
predicted protein[2]; putative lipoprotein[3] Novel verified lipoprotein, function unknown[4] |
| Product Synonyms(s) |
predicted protein[1], B2809[2][1], YgdI[2][1] , ECK2805, JW5448, b2809 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
ygdI and ygdR are paralogs. First 19 aa are a type II signal peptide.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ygdI |
|---|---|
| Mnemonic |
Systematic nomenclature |
| Synonyms |
ECK2805, b2809, JW5448[1], JW5448 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.39 minutes |
MG1655: 2941167..2940940 |
||
|
NC_012967: 2837764..2837537 |
||||
|
NC_012759: 2828088..2828315 |
||||
|
W3110 |
|
W3110: 2941801..2941574 |
||
|
DH10B: 3035037..3034810 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔygdI (Keio:JW5448) |
deletion |
deletion |
PMID:16738554 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5448 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAAAAGACTGCCGCAATTAT Primer 2:CCtTGATCCAGTTCGACCATCTC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 75% [6] | ||
|
Linked marker |
est. P1 cotransduction: 71% [6] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G7453 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13081 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120004016 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB2890 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009214 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
YgdI |
|---|---|
| Synonyms |
predicted protein[1], B2809[2][1], YgdI[2][1] , ECK2805, JW5448, b2809 |
| Product description |
predicted protein[2]; putative lipoprotein[3] Novel verified lipoprotein, function unknown[4] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0031225 |
anchored to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9901 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes | |
|---|---|---|---|---|---|
|
Outer membrane |
PMID:15174130 |
| |||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MMKKTAAIIS ACMLTFALSA CSGSNYVMHT NDGRTIVSDG KPQTDNDTGM ISYKDANGNK QQINRTDVKE MVELDQ |
| Length |
76 |
| Mol. Wt |
8.305 kDa |
| pI |
5.7 (calculated) |
| Extinction coefficient |
2,980 - 3,230 (calc based on 2 Y, 0 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0009214 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:G7453 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13081 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120004016 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2890 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
386 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
1606 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
332 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:2941147..2941187
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for ygdI | |
|
microarray |
Summary of data for ygdI from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (2941073..2941439) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to ygdI Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G7453 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2890 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13081 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120004016 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009214 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
S3018 |
From SHIGELLACYC |
|
E. coli O157 |
Z4126 |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:G7453 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG13081 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120004016 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2890 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0009214 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories


