ybhM:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

ybhM

Gene Synonym(s)

ECK0776, b0787, JW0770[1], JW0770

Product Desc.

conserved inner membrane protein[2][3]

Function unknown[4]

Product Synonyms(s)

conserved inner membrane protein[1], B0787[2][1], YbhM[2][1] , ECK0776, JW0770, b0787

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): ybhM[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]





Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

ybhM

Mnemonic

Systematic nomenclature

Synonyms

ECK0776, b0787, JW0770[1], JW0770

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

17.67 minutes 

MG1655: 820016..820729
<gbrowseImage> name=NC_000913:820016..820729 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 813418..814131
<gbrowseImage> name=NC_012967:813418..814131 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 722984..723697
<gbrowseImage> name=NC_012759:722984..723697 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 821215..821928
<gbrowseImage> name=NC_007779:821215..821928 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 873944..874657
<gbrowseImage> name=NC_010473:873944..874657 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔybhM (Keio:JW0770)

deletion

deletion

PMID:16738554

Shigen
CGSC8827[5]

ΔybhM759::kan

PMID:16738554

CGSC:103818


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0770

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGAATCATACTCGCAAAACAG

Primer 2:CCATGAAAAAAACGCGTATGCCT

3D4

Kohara Phage

Genobase

PMID:3038334

24F9

Kohara Phage

Genobase

PMID:3038334

nadA57::Tn10

Linked marker

CAG12147 = CGSC7351[5]

est. P1 cotransduction: 18% [6]

zbh-29::Tn10

Linked marker

CAG18493 = CGSC7353[5]

est. P1 cotransduction: 96% [6]
Synonyms:zbi-29::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G6404

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13669

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003004

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:949001

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3433

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002688

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

YbhM

Synonyms

conserved inner membrane protein[1], B0787[2][1], YbhM[2][1] , ECK0776, JW0770, b0787

Product description

conserved inner membrane protein[2][3]

Function unknown[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-1003

C

Seeded from EcoCyc (v14.0)

complete

GO:0016020

membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0472

C

Seeded from EcoCyc (v14.0)

complete

GO:0016021

integral to membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0812

C

Seeded from EcoCyc (v14.0)

complete

GO:0016021

integral to membrane

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-9909

C

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

plasma membrane

C-terminus localized in the cytoplasm with 6 predicted transmembrane domains

Daley et al. (2005) [7]


<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MESYSQNSNK LDFQHEARIL NGIWLITALG LVATAGLAWG AKYIEITATK YDSPPMYVAI
GLLLLCMYGL SKDINKINAA IAGVIYLFLL SLVAIVVASL VPVYAIIIVF STAGAMFLIS
MLAGLLFNVD PGSHRFIIMM TLTGLALVII VNAALMSERP IWIISCLMIV LWSGIISHGR
NKLLELAGKC HSEELWSPVR CAFTGALTLY YYFIGFFGIL AAIAITLVWQ RHTRFFH
Length

237

Mol. Wt

26.124 kDa

pI

8.6 (calculated)

Extinction coefficient

47,900 - 48,400 (calc based on 10 Y, 6 W, and 4 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

<motif_map/>

tmhmm.php?gene=ybhM&show=pic&.jpg
Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ybhM taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16128755

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:949001

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002688

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P75769

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G6404

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13669

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:949001

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003004

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3433

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

16a

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Protein

E. coli K-12 MG1655

6a

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

ybhM

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:819996..820036 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b0787 (EcoliWiki Page)

NCBI GEO profiles for ybhM

microarray

GenExpDB:b0787 (EcoliWiki Page)

Summary of data for ybhM from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (819735..820050) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ13; Well:C5[8]

<protect></protect>

Notes

Accessions Related to ybhM Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G6404

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3433

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b0787

EcoGene

EcoGene:EG13669

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003004

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002688

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Shigella flexneri

YBHM

From SHIGELLACYC

E. coli O157

YBHM

From ECOO157CYC


Do-It-Yourself Web Tools

<protect></protect>

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Panther (EcoliWiki Page)

PTHR23291:SF3

EcoCyc

EcoCyc:G6404

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13669

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003004

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3433

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002688

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed
  8. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

Categories

[back to top]