uvrB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
uvrB |
|---|---|
| Mnemonic |
UV resistant |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
17.52 minutes |
MG1655: 812749..814770 |
||
|
NC_012967: 806152..808173 |
||||
|
NC_012759: 715717..717738 |
||||
|
W3110 |
|
W3110: 813948..815969 |
||
|
DH10B: 866677..868698 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
812752 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
uvrB(del) (Keio:JW0762) |
deletion |
deletion |
|||||
|
uvrBY95+Y96 |
Y95A and Y96A |
Altered enzymatic activity |
Defective in DNA-unwinding activity |
seeded from UniProt:P0A8F8 | |||
|
uvrBY101+F108 |
Y101A and F108A |
Altered enzyme activity |
Defective in DNA-unwinding activity |
seeded from UniProt:P0A8F8 | |||
|
uvrB45 |
Sensitivity to |
Mutant increases in sensitivity after high UV-radiation exposure |
Figure 5 Strain: Hfr Hayes | ||||
|
uvrB16 |
|||||||
|
uvrB5 |
|||||||
|
uvrB27 |
|||||||
|
uvrB29 |
|||||||
|
uvrB30 |
|||||||
|
uvrB501 |
|||||||
|
uvrB151 |
|||||||
|
uvrB153 |
|||||||
|
uvrB230 |
|||||||
|
uvrB751(del)::kan |
|||||||
|
uvrB5 |
deletion |
deletion |
Sensitivity to |
Deletion of uvrB caused hypersensitivity to PUVA (UVA-A light) treatments performed with both mono-functional 3-carbethoxypsoralen and bifunctional 8-Monofunctional psoralens when compared to wildtype, figure 1 & 2. |
parent strain: AB1157 |
||
|
uvrB(del) |
Deletion |
Deletion |
Sensitivity to |
Gene deletion enhances SOS chromatest assay sensitivity for nitroreductases which can be used for CB1954-mediated gene therapy. |
|||
|
uvrB301(del) |
complete null mutant |
complete null mutant |
Sensitivity to |
Deletion mutants are more sensitive to DNA damaging agent Mitomycin C, |
Experimental strain: JC3890 |
Figures 1 & 2 illustrate experimental results. | |
|
uvrB5 |
point mutation |
Sensitivity to |
truncation mutation was more sensitive to lower mitomycin C concentrations than complete null mutation, uvrB301(del), |
See figure 2 for full experimental results. | |||
|
uvrB(del) |
deletion |
deletion |
Sensitivity to |
Deletion mutation causes hypersensitive to UV when irradiated and incubated in non-photoreactivating conditions, fig 2. |
|||
|
uvrB5 |
point mutation |
DNA repair |
truncation mutation resulted in increasing amounts of DNA strand breaks. |
See figure 4 for results. | |||
|
uvrBK45A |
Lysine to alanine |
change in enzyme activity |
ATP hydrolysis by uvrB is inhibited. |
Table 1. | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0762 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTAAACCGTTCAAACTGAA Primer 2:CCCGATGCCGCGATAAACAGCTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 26% [16] | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 75% [16] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Arikan, E et al. (1986) Sequences of the E. coli uvrB gene and protein. Nucleic Acids Res. 14 2637-50 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 Moolenaar, GF et al. (2001) Clue to damage recognition by UvrB: residues in the beta-hairpin structure prevent binding to non-damaged DNA. EMBO J. 20 6140-9 PubMed
- ↑ Howard-Flanders, P et al. (1966) Three loci in Escherichia coli K-12 that control the excision of pyrimidine dimers and certain other mutagen products from DNA. Genetics 53 1119-36 PubMed
- ↑ Drapeau, GR et al. (1983) Unusual properties of a new division mutant of Escherichia coli. Can. J. Microbiol. 29 694-9 PubMed
- ↑ Lage, C et al. (2010) Differential survival of Escherichia coli uvrA, uvrB, and uvrC mutants to psoralen plus UV-A (PUVA): Evidence for uncoupled action of nucleotide excision repair to process DNA adducts. J. Photochem. Photobiol. B, Biol. 98 40-7 PubMed
- ↑ Prosser, GA et al. (2010) uvrB gene deletion enhances SOS chromotest sensitivity for nitroreductases that preferentially generate the 4-hydroxylamine metabolite of the anti-cancer prodrug CB1954. J. Biotechnol. 150 190-4 PubMed
- ↑ 11.0 11.1 11.2 Vidal, LS et al. (2006) Enhanced sensitivity of Escherichia coli uvrB mutants to mitomycin C points to a UV-C distinct repair for DNA adducts. Chem. Res. Toxicol. 19 1351-6 PubMed
- ↑ Crowley, DJ et al. (2006) The uvrA, uvrB and uvrC genes are required for repair of ultraviolet light induced DNA photoproducts in Halobacterium sp. NRC-1. Saline Syst. 2 11 PubMed
- ↑ Malta, E et al. (2007) Dynamics of the UvrABC nucleotide excision repair proteins analyzed by fluorescence resonance energy transfer. Biochemistry 46 9080-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 15.0 15.1 15.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 16.0 16.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
