thyA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
thyA |
|---|---|
| Mnemonic |
Thymine |
| Synonyms |
ECK2823, b2827, JW2795[1], JW2795 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.85 minutes |
MG1655: 2963177..2962383 |
||
|
NC_012967: 2859775..2858981 |
||||
|
NC_012759: 2849531..2850325 |
||||
|
W3110 |
|
W3110: 2963811..2963017 |
||
|
DH10B: 3057047..3056253 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2962383 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
thyA(del) (Keio:JW2795) |
deletion |
deletion |
|||||
|
thyA751 |
|||||||
|
thyA25 |
|||||||
|
thyA715 |
|||||||
|
thyA36 |
|||||||
|
thyA6 |
|||||||
|
thyA47 |
|||||||
|
thyA52 |
|||||||
|
thyA12 |
|||||||
|
thyA704 |
|||||||
|
thyA3 |
|||||||
|
thyA81 |
|||||||
|
thyA82 |
|||||||
|
thyA56 |
|||||||
|
thyA117 |
|||||||
|
thyA61 |
|||||||
|
thyA144 |
|||||||
|
thyA54 |
|||||||
|
thyA42 |
|||||||
|
thyA748::Tn10 |
|||||||
|
thyA147 |
|||||||
|
thyA148 |
|||||||
|
thyA45 |
|||||||
|
thyA702 |
|||||||
|
thyA55 |
|||||||
|
thyA43 |
|||||||
|
thyA11 |
|||||||
|
thyA24 |
|||||||
|
thyA305 |
|||||||
|
thyA14 |
|||||||
|
thyA33 |
|||||||
|
thyA114(Stable)::Mu |
|||||||
|
thyA20 |
|||||||
|
thyA707 |
|||||||
|
thyA111 |
|||||||
|
thyA16 |
|||||||
|
thyA15 |
|||||||
|
thyA705 |
|||||||
|
thyA48 |
|||||||
|
thyA714 |
|||||||
|
thyA95 |
|||||||
|
thyA44 |
|||||||
|
thyA710 |
|||||||
|
thyA0 |
|||||||
|
thyA299 |
|||||||
|
thyA59 |
|||||||
|
thyA746 |
|||||||
|
thyA752(del) |
|||||||
|
thyA719 |
|||||||
|
thyA755 |
|||||||
|
thyA756 |
|||||||
|
thyA57(del) |
|||||||
|
thyA758 |
|||||||
|
thyA38 |
|||||||
|
thyA26 |
|||||||
|
thyA41 |
|||||||
|
thyA23 |
|||||||
|
thyA325 |
|||||||
|
thyA46 |
|||||||
|
thyA2 |
|||||||
|
thyA18 |
|||||||
|
thyA34 |
|||||||
|
thyA10 |
|||||||
|
thyA39 |
|||||||
|
thyA29 |
|||||||
|
thyA27 |
|||||||
|
thyA53 |
|||||||
|
thyA28 |
|||||||
|
thyA30 |
|||||||
|
thyA31 |
|||||||
|
thyA49 |
|||||||
|
thyA709 |
|||||||
|
thyA17 |
|||||||
|
thyA51 |
|||||||
|
thyA321 |
|||||||
|
thyA58 |
|||||||
|
thyA50 |
|||||||
|
thyA40 |
|||||||
|
thyA333 |
|||||||
|
thyA9999(ts)::Mud(Ap,lac) |
temperature sensitive |
||||||
|
thyA149 |
|||||||
|
thyA101 |
|||||||
|
thyA9 |
|||||||
|
thyA326 |
|||||||
|
thyA753 |
|||||||
|
thyA281 |
|||||||
|
thyA294 |
|||||||
|
thyA119 |
|||||||
|
thyA760 |
|||||||
|
thyA749 |
|||||||
|
thyA750 |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2795 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACAGTATTTAGAACTGAT Primer 2:CCGATAGCCACCGGCGCTTTAAT | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 67% [7] | ||
|
Linked marker |
est. P1 cotransduction: % [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Belfort, M et al. (1983) Primary structure of the Escherichia coli thyA gene and its thymidylate synthase product. Proc. Natl. Acad. Sci. U.S.A. 80 4914-8 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
