tatC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tatC |
|---|---|
| Mnemonic |
Twin arginine translocation |
| Synonyms |
ECK3832, b3839, JW3815, mttA2, mttB, yigUV, ysgB, yigU, yigV[1], yigV |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
86.66 minutes |
MG1655: 4020759..4021535 |
||
|
NC_012967: 4001207..4001983 |
||||
|
NC_012759: 3910428..3911204 |
||||
|
W3110 |
|
W3110: 3613945..3613169 |
||
|
DH10B: 4119679..4120455 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
tatC(del) (Keio:JW3815) |
deletion |
deletion |
|||||
|
tatCD211E,N |
D211E,N |
Decrease in torA export activity |
seeded from UniProt:P69423 | ||||
|
tatCR17A |
R17A |
No anaerobic growth and no torA export |
seeded from UniProt:P69423 | ||||
|
tatC |
Deletion | ||||||
|
tatCL20A |
L20A |
25% decrease in anaerobic growth and 75% decrease in torA export |
seeded from UniProt:P69423 | ||||
|
tatCE103Q |
E103Q |
Severely retard but does not abolish activity |
seeded from UniProt:P69423 | ||||
|
tatCD211A |
D211A |
Export activity of torA blocked. Export of torA restored; when associated with A-94 or A-103 |
seeded from UniProt:P69423 | ||||
|
tatCF94A,L |
F94A,L |
Loss of function |
seeded from UniProt:P69423 | ||||
|
tatCF94A |
F94A |
Export of torA restored; when associated with A-211 |
seeded from UniProt:P69423 | ||||
|
tatCE103A,D,R |
E103A,D,R |
Loss of function |
seeded from UniProt:P69423 | ||||
|
tatCE103A |
E103A |
Export of torA restored; when associated with A-211 |
seeded from UniProt:P69423 | ||||
|
tatC781(del)::kan |
|||||||
|
tatC(del) |
Sensitivity to |
Strain carrying deletion at tatC locus which encodes a subunit of the twin argenine translocation complex (tat)used for protein secretion, exhibited increased susceptibility to protamine, Alpha helical CAMPs magainin 2 and melittin. Fig 1 and 2 |
Parent strain: BW25113 |
||||
|
tatC781(del)::FRTKanFRT |
deletion |
Mutagenesis rate |
Decrease in Stress Induced Mutagenesis (SIM) |
Parent Strain: SMR4562 Experimental Stain: SMR12008 |
The mutation caused a significant decrease in SIM with mutant frequency reduced by 68 t0 89 percent of the wild type. See table S3 for full experimental data. | ||
|
tatC781(del)::FRTKanFRT |
deletion |
Sensitivity to |
SDS-EDTA Sensitivity |
Parent Strain: SMR4562 Experimental Stain: SMR12008 |
The mutation conferred an increase in SDS-EDTA sensitivity. See table S7 and S1 for a summary of experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3815 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTGTAGAAGATACTCAACC Primer 2:CCTTCTTCAGTTTTTTCGCTTTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 66% [8] | |
|
Linked marker |
est. P1 cotransduction: 80% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Weatherspoon-Griffin, N et al. (2011) The CpxR/CpxA two-component system up-regulates two Tat-dependent peptidoglycan amidases to confer bacterial resistance to antimicrobial peptide. J. Biol. Chem. 286 5529-39 PubMed
- ↑ 5.0 5.1 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
