rpsB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsB |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK0168, b0169, JW0164[1], JW0164 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.09 minutes |
MG1655: 189874..190599 |
||
|
NC_012967: 192716..193441 |
||||
|
NC_012759: 189873..190598 |
||||
|
W3110 |
|
W3110: 189874..190599 |
||
|
DH10B: 163978..164703 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
189877 |
Edman degradation |
PMID:1575737[2] |
| |
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpsB2236(ts) |
temperature sensitive |
||||||
|
rpsB in NH63 |
spcr was added through the P1 transduciton from Spc-49-1 |
Resistant to |
Cold sensitivity was suppressed though resistance to spc was maintained. |
See Figure 1. The strain has a background in AB1157 CGSC 1157 | |||
|
rpsB in strain YC80 |
Resistant to |
Resistance to Kasugamycin |
Strain: YC80 |
||||
|
rpsB in strain AB312 |
Resistant to |
Resistance to Kasugamycin |
Strain: AB312 |
Traceable author statement. | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0164 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAACTGTTTCCATGCGCGA Primer 2:CCCTCAGCTTCTACGAAGCTTTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 17% [13] | ||
|
Linked marker |
est. P1 cotransduction: 16% [13] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Ueshima, R et al. (1992) Identification of Escherichia coli proteins cross-reacting with antibodies against region 2.2 peptide of RNA polymerase sigma subunit. Biochem. Biophys. Res. Commun. 184 634-9 PubMed
- ↑ Wittmann-Liebold, B & Bosserhoff, A (1981) Primary structure of protein S2 from the Escherichia coli ribosome. FEBS Lett. 129 10-6 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Hoving, S et al. (2000) A method for the chemical generation of N-terminal peptide sequence tags for rapid protein identification. Anal. Chem. 72 1006-14 PubMed
- ↑ Bollen, A et al. (1979) A conditionally lethal mutation of Escherichia coli affecting the gene coding for ribosomal protein S2 (rpsB). J. Mol. Biol. 132 219-33 PubMed
- ↑ Nashimoto, H & Uchida, H (1975) Late steps in the assembly of 30 S ribosomal proteins in vivo in a spectinomycin-resistant mutant of Escherichia coli. J. Mol. Biol. 96 443-53 PubMed
- ↑ Yoshikawa, M et al. (1975) A third kasugamycin resistance locus, ksgC, affecting ribosomal protein S2 in Escherichia coli K-12. J. Bacteriol. 122 796-7 PubMed
- ↑ Okuyama, A et al. (1974) Alteration of ribosomal protein S2 in kasugamycin-resistant mutant derived from Escherichia coli AB312. Biochem. Biophys. Res. Commun. 60 1163-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 12.0 12.1 CGSC: The Coli Genetics Stock Center
- ↑ 13.0 13.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
