rplV:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rplV |
|---|---|
| Mnemonic |
Ribosomal protein, large |
| Synonyms |
ECK3302, b3315, JW3277, eryB[1], eryB |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.31 minutes, 74.31 minutes |
MG1655: 3448255..3447923 |
||
|
NC_012967: 3378138..3377806 |
||||
|
NC_012759: 3335080..3335412 |
||||
|
W3110 |
|
W3110: 4190183..4190515 |
||
|
DH10B: 3546000..3545668 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3447923 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rplV |
Deletion | ||||||
|
rplV |
Deletion | ||||||
|
rplVA93S,T,V |
A93S,T,V |
Abolishes translation elongation arrest of secM |
seeded from UniProt:P61175 | ||||
|
rplVR8C |
R8C |
(in strain: SK1048; decreases translational rate, tRNA binding and subunit association at 44 degrees Celsius; does not alter 23S rRNA or L4 interactions; not erythromycin resistant) |
Strain variation; seeded from UniProt:P61175 | ||||
|
rplV |
Deletion | ||||||
|
rplVG91A,D,S |
G91A,D,S |
Abolishes translation elongation arrest of secM |
seeded from UniProt:P61175 | ||||
|
rplV281 |
|||||||
|
rplV in strains N281 |
Resistant to |
altered protein 50-13(=L22) makes mutant Resistance to erythromycin |
strains: N281, N289, N21, N54, N486 |
||||
|
rplV09 |
Resistant to |
Erythromycin resistance at the permissive temperatures above 32C |
Strain: 345-09 |
See tables 1 and table 6 | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3277 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGAAACTATCGCTAAACATCG Primer 2:CCGCGATCGGACACAACCACAGT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 50% [8] | ||
|
Linked marker |
est. P1 cotransduction: 7% [8] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Wittmann-Liebold, B & Greuer, B (1980) Amino acid sequence of protein L22 from the large subunit of the Escherichia coli ribosome. FEBS Lett. 121 105-12 PubMed
- ↑ Wittmann, HG et al. (1973) Biochemical and genetic studies on two different types of erythromycin resistant mutants of Escherichia coli with altered ribosomal proteins. Mol. Gen. Genet. 127 175-89 PubMed
- ↑ Pardo, D & Rosset, R (1977) Properties of ribosomes from erythromycin resistant mutants of Escherichia coli. Mol. Gen. Genet. 156 267-71 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
