rplF:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rplF |
|---|---|
| Mnemonic |
Ribosomal protein, large |
| Synonyms |
ECK3292, b3305, JW3267[1], JW3267 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.22 minutes |
MG1655: 3444162..3443629 |
||
|
NC_012967: 3374045..3373512 |
||||
|
NC_012759: 3330786..3331319 |
||||
|
W3110 |
|
W3110: 4194276..4194809 |
||
|
DH10B: 3541907..3541374 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3443632 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rplF15 |
amino acids 152 to 177 replaced by Ala-Leu |
Resistant to |
(in gentamicin resistant strain: GS50-15), table 4 |
Strain: GS50-15 |
| ||
|
rplF8 |
amino acids 158 – 177 replaced by Thr-Leu |
Resistant to |
(in gentamicin resistant strain: GS20-8) |
Strain variation; seeded from UniProt:P0AG55 | |||
|
rplF8 |
7-nt insertion at nucleotide 2722, which introduces a frameshift and a premature stop codon |
amino acid residues 158 to 177 replaced by Thr-Leu |
Resistant to |
gentamycin resistant, table 4 |
Strain: GE20-8 |
sequence: [5] | |
|
rplF10 |
Resistant to |
gentamycin resistant |
Strain: GE20-10 |
Table 4 | |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3267 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTCTCGTGTTGCTAAAGCACC Primer 2:CCtTTCTTCTTAGCCTCTTTGGT | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 59% [9] | ||
|
Linked marker |
est. P1 cotransduction: 5% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Chen, R & Ehrke, G (1976) The primary structure of the 5 S RNA binding protein L5 of Escherichia coli ribosomes. FEBS Lett. 69 240-5 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 4.0 4.1 4.2 4.3 Buckel, P et al. (1977) Alteration of ribosomal protein L6 in mutants of Escherichia coli resistant to gentamicin. Mol. Gen. Genet. 158 47-54 PubMed
- ↑ Davies, C et al. (1998) Ribosomal proteins S5 and L6: high-resolution crystal structures and roles in protein synthesis and antibiotic resistance. J. Mol. Biol. 279 873-88 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
