ribB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ribB |
|---|---|
| Mnemonic |
Riboflavin |
| Synonyms |
ECK3032, b3041, JW3009, htrP, luxH-I, luxH, luxH-, luxH-l[1][2] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
68.58 minutes |
MG1655: 3182488..3181835 |
||
|
NC_012967: 3118638..3117985 |
||||
|
NC_012759: 3068983..3069636 |
||||
|
W3110 |
|
W3110: 3183122..3182469 |
||
|
DH10B: 3280233..3279580 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3181835 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ribBD33S |
D33S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBE35S |
E35S |
Reduces activity by 85% |
seeded from UniProt:P0A7J0 | ||||
|
ribBR37E |
R37E |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBD42S |
D42S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBC67S |
C67S |
Reduces activity by 80% |
seeded from UniProt:P0A7J0 | ||||
|
ribBT107S |
T107S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBS110A |
S110A |
Reduces activity by 85% |
seeded from UniProt:P0A7J0 | ||||
|
ribBD113S |
D113S |
Reduces activity by 88% |
seeded from UniProt:P0A7J0 | ||||
|
ribBT117A |
T117A |
Reduces activity by 75% |
seeded from UniProt:P0A7J0 | ||||
|
ribBE40S |
E40S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBE38S |
E38S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBH136S |
H136S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBR150S |
R150S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBH153S |
H153S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribBE155S |
E155S |
Reduces activity by 83% |
seeded from UniProt:P0A7J0 | ||||
|
ribBE174S |
E174S |
Loss of activity |
seeded from UniProt:P0A7J0 | ||||
|
ribB30::Tn5 |
|||||||
|
ribB11::Tn5 |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3009 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATCAGACGCTACTTTCCTC Primer 2:CCGCTGGCTTTACGCTCATGTGC | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 89% [7] | ||
|
Linked marker |
est. P1 cotransduction: 26% [7] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Richter, G et al. (1992) Biosynthesis of riboflavin: cloning, sequencing, and expression of the gene coding for 3,4-dihydroxy-2-butanone 4-phosphate synthase of Escherichia coli. J. Bacteriol. 174 4050-6 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).