purA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
purA |
|---|---|
| Mnemonic |
Purine |
| Synonyms |
ECK4173, b4177, JW4135, Ad4, adeK[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
94.89 minutes |
MG1655: 4402710..4404008 |
||
|
NC_012967: 4382842..4384140 |
||||
|
NC_012759: 4341445..4342743 |
||||
|
W3110 |
|
W3110: 4409367..4410665 |
||
|
DH10B: 4503072..4504370 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4402713 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
purA(del) (Keio:JW4135) |
deletion |
deletion |
|||||
|
purAK141I |
K141I |
Total loss of activity |
seeded from UniProt:P0A7D4 | ||||
|
purAG16V |
G16V |
Significant reduction in activity |
seeded from UniProt:P0A7D4 | ||||
|
purAG13V |
G13V |
Significant reduction in activity |
seeded from UniProt:P0A7D4 | ||||
|
purAG18V |
G18V |
Significant reduction in activity |
seeded from UniProt:P0A7D4 | ||||
|
purAI20T |
I20T |
Significant reduction in activity |
seeded from UniProt:P0A7D4 | ||||
|
purAR148L |
R148L |
Reduced activity |
seeded from UniProt:P0A7D4 | ||||
|
purAK19R |
K19R |
Significant reduction in activity |
seeded from UniProt:P0A7D4 | ||||
|
purA54 |
|||||||
|
purA45 |
|||||||
|
purA44 |
|||||||
|
purA206(Stable,TempR,ApR)::Mud |
|||||||
|
purA46 |
|||||||
|
purA727(del)::kan |
|||||||
|
purA + |
Sensitivity to |
Sensitivity to Nalidixic acid |
ES4 |
figure 1 | |||
|
purA in strains B and W-11 |
Resistant to |
Resistance to Methyl(6)purine + hypoxanthine |
B and W-11 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4135 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGGTAACAACGTCGTCGTACT Primer 2:CCgGCGTCGAACGGGTCGCGCAG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 13% [10] | ||
|
Linked marker |
est. P1 cotransduction: 42% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Wolfe, SA & Smith, JM (1988) Nucleotide sequence and analysis of the purA gene encoding adenylosuccinate synthetase of Escherichia coli K12. J. Biol. Chem. 263 19147-53 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ Helling, RB & Adams, BS (1970) Nalidixic acid-resistant auxotrophs of Escherichia coli. J. Bacteriol. 104 1027-9 PubMed
- ↑ Benson, CE et al. (1970) Inhibition of de novo purine biosynthesis and interconversion by 6-methylpurine in Escherichia coli. J. Bacteriol. 101 872-80 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).