pgi:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
pgi |
|---|---|
| Mnemonic |
Phosphoglucose isomerase |
| Synonyms |
ECK4017, b4025, JW3985[1], JW3985 |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
91.21 minutes |
MG1655: 4231781..4233430 |
||
|
NC_012967: 4212689..4214338 |
||||
|
NC_012759: 4121461..4123110 |
||||
|
W3110 |
|
W3110: 4237348..4238997 |
||
|
DH10B: 4331477..4333126 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
pgi(del) (Keio:JW3985) |
deletion |
deletion |
|||||
|
pgi-2 |
|||||||
|
pgi-7::Mu |
|||||||
|
pgi-10 |
|||||||
|
pgi-1 |
|||||||
|
pgi-721(del)::kan |
|||||||
|
pgi::Tn15 |
Growth Phenotype |
allows expression of the lac operon in the presence of glucose |
|||||
|
pgi |
Resistant to |
fosfomycin + fructose-6-phosphate resistance |
|||||
|
pgi721(del)FRTKanFRT |
deletion |
Mutagenesis Rate |
Decreased Stress Induced Mutagenesis (SIM). |
Parent Strain: SMR4562 Experimental Strain: SMR11995 |
The mutation conferred a medium decrease in SIM with mutant frequency being decreased by 68 to 89 percent. See table S3 for full experimental data. | ||
|
pgi721(del)FRTKanFRT |
deletion |
Sensitivity to |
Increased UV sensitivity |
Parent Strain: SMR4562 Experimental Strain: SMR11995 |
See table S7 and S1 for a summary of experimental data. | ||
|
SMR6039 pgi721(del)FRTKanFRT |
deletion |
SOS response |
Decrease in spontaneous SOS-induction response activity |
Parent Strain: SMR6039 Experimental Strain: SMR15962 |
See table S7 for a summary of experimental data. | ||
|
SMR4562 yiaG-yfp FRTcatFRT pgi721(del)::FRTKanFRT |
Deletion |
Sigma S activity |
Decrease in SigmaS activity |
Parental Strain: SMR10582 Experimental Strain: SMR13295 |
See table S8 for full experimental data. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3985 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAACATCAATCCAACGCA Primer 2:CCACCGCGCCACGCTTTATAGCG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 21% [9] | ||
|
Linked marker |
est. P1 cotransduction: 74% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Kimata, K et al. (1998) A global repressor (Mlc) is involved in glucose induction of the ptsG gene encoding major glucose transporter in Escherichia coli. Mol. Microbiol. 29 1509-19 PubMed
- ↑ Friedberg, I (1972) Localization of phosphoglucose isomerase in Escherichia coli and its relation to the induction of the hexose phosphate transport system. J. Bacteriol. 112 1201-5 PubMed
- ↑ 6.0 6.1 6.2 6.3 Al Mamun, AA et al. (2012) Identity and function of a large gene network underlying mutagenic repair of DNA breaks. Science 338 1344-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
