pdxJ:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
pdxJ |
---|---|
Mnemonic |
Pyridoxine |
Synonyms |
ECK2562, b2564, JW2548[1], JW2548 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
58.17 minutes, 58.17 minutes |
MG1655: 2699751..2699020 |
||
NC_012967: 2623221..2622490 |
||||
NC_012759: 2584825..2585556 |
||||
W3110 |
|
W3110: 2700385..2699654 |
||
DH10B: 2791516..2790785 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
2699023 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔpdxJ (Keio:JW2548) |
deletion |
deletion |
|||||
pdxJG194S |
G194S |
(in pdxH null mutation suppressor) |
Strain variation; seeded from UniProt:P0A794 | ||||
pdxJ19 |
|||||||
pdxJ20(ts) |
Growth Phenotype |
temperature sensitive |
|||||
ΔpdxJ736::kan |
|||||||
pdxJ8::ΔTn10 |
Auxotrophies |
Insertion of (A8) mutation causes dependency of pyridoxine for growth, Table 4. |
Strain History: W3110 | ||||
ΔpdxJ |
deletion |
deletion |
Auxotrophies |
Deletion causes pyridoxine synthesis to halt causing growth to halt. Figure 1. |
Strain History: TX1918 |
||
ΔpdxJ/PDX1 |
Reciprocal transformation |
Reciprocal transformation |
Growth Phenotype |
Gene, PDX1, from Cercospora nicotianae incorporated into E. coli will restore pyridoxine biosynthesis that deletion of pdxJ halted. Growth rate was slower, Figure 1. |
|||
pdxJ-G194S |
Single G-To-A transition at nt 2230 in "pdxJ". (Used the numbering in Lam et al. 1992.[6] |
Singe amino acid change of glycine to serine at position 194 in the pdxJ polypeptide chain |
Null Bypass Mutation |
The pdxJ-S194G mutation enables the growth of ΔpdxH::ΩCmR without pyridoxal (see text on pg 2446). |
|||
pdxJ::mini-mud |
Insertions 3 to 5 in figure 2. |
Auxotrophies |
Insertion mutation inhibited growth of the mutant strain. Insertions 3 to 5 in Figure 2. |
| |||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2548 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTGAATTACTGTTAGGCGT Primer 2:CCGCCACGCGCTTCCAGCATCAG | |
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 23% [10] | ||
Linked marker |
est. P1 cotransduction: 70% [10] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Takiff, HE et al. (1992) Locating essential Escherichia coli genes by using mini-Tn10 transposons: the pdxJ operon. J. Bacteriol. 174 1544-53 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 Wetzel, DK et al. (2004) Functional complementation between the PDX1 vitamin B6 biosynthetic gene of Cercospora nicotianae and pdxJ of Escherichia coli. FEBS Lett. 564 143-6 PubMed
- ↑ 6.0 6.1 Lam, HM et al. (1992) Suppression of insertions in the complex pdxJ operon of Escherichia coli K-12 by lon and other mutations. J. Bacteriol. 174 1554-67 PubMed
- ↑ Man, TK et al. (1996) Isolation of a pdxJ point mutation that bypasses the requirement for the PdxH oxidase in pyridoxal 5' -phosphate coenzyme biosynthesis in Escherichia coli K-12. J. Bacteriol. 178 2445-9 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).