nikE:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Standard Name |
nikE |
---|---|
Gene Synonym(s) |
ECK3464, b3480, JW3445, hydD, hydC[1], hydC |
Product Desc. |
Component of nickel ABC transporter[2][3] Nickel transport ATP-binding protein[4] |
Product Synonyms(s) |
nickel transporter subunit[1], ATP-binding component of ABC superfamily[1], B3480[2][1], HydC[2][1], HydD[2][1], NikE[2][1] , ECK3464, hydC, hydD, JW3445, b3480 |
Function from GO |
<GO_nr /> |
Knock-Out Phenotype | |
Regulation/Expression | |
Regulation/Activity | |
Quick Links | |
edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
Mutants display nickel-remediated formate hydrogen-lyase, hydrogenase, and hydrogenase-related fumarase defects. Overexpression causes abnormal biofilm architecture.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
nikE |
---|---|
Mnemonic |
Nickel |
Synonyms |
ECK3464, b3480, JW3445, hydD, hydC[1], hydC |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
77.93 minutes |
MG1655: 3615799..3616605 |
||
NC_012967: 3548464..3549270 |
||||
NC_012759: 3504293..3505099 |
||||
W3110 |
|
W3110: 4022639..4021833 |
||
DH10B: 3713544..3714350 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
ΔnikE (Keio:JW3445) |
deletion |
deletion |
PMID:16738554 |
||||
ΔnikE734::kan |
PMID:16738554 |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3445 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACTTTACTTAACATCTCCGG Primer 2:CCAACCTTTTCTGTGGTGCGACG | |
Kohara Phage |
PMID:3038334 | ||
Kohara Phage |
PMID:3038334 | ||
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: 40% [6] | |
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001985 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EchoBASE:EB2004 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0011362 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
Standard name |
NikE |
---|---|
Synonyms |
nickel transporter subunit[1], ATP-binding component of ABC superfamily[1], B3480[2][1], HydC[2][1], HydD[2][1], NikE[2][1] , ECK3464, hydC, hydD, JW3445, b3480 |
Product description |
Component of nickel ABC transporter[2][3] Nickel transport ATP-binding protein[4] |
EC number (for enzymes) |
|
edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
---|---|---|---|---|---|---|---|---|
GO:0000166 |
nucleotide binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003593 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0000166 |
nucleotide binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0547 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003439 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR015858 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017871 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005524 |
ATP binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0067 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014137 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006810 |
transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015413 |
nickel-transporting ATPase activity |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01712 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015413 |
nickel-transporting ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014137 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015413 |
nickel-transporting ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR015858 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015413 |
nickel-transporting ATPase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.6.3.24 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015675 |
nickel ion transport |
GOA:hamap |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01712 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015675 |
nickel ion transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014137 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015675 |
nickel ion transport |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR015858 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0015675 |
nickel ion transport |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0921 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR015858 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016151 |
nickel ion binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014137 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016151 |
nickel ion binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0533 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016787 |
hydrolase activity |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0378 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016887 |
ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003439 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0016887 |
ATPase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR017871 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0017111 |
nucleoside-triphosphatase activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003593 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
GO:0006974 |
response to DNA damage stimulus |
PMID:11967071 |
IEP: Inferred from Expression Pattern |
P |
complete | |||
GO:0019898 |
extrinsic to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9903 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
Partner Type | Partner | Notes | References | Evidence |
---|---|---|---|---|
Protein |
Subunits of nickel ABC transporter |
could be indirect |
||
Protein |
groL |
PMID:16606699 |
Experiment(s):EBI-1146002 | |
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1146002 | |
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
rpsD |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
secA |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
srmB |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-879814 | |
Protein |
rpsD |
PMID:19402753 |
MALDI(Z-score):35.547108 | |
edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
Compartment | Description | Evidence | Reference/Source | Notes |
---|---|---|---|---|
cytoplasm |
From EcoCyc[3] |
| ||
edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
Name | |
---|---|
Sequence |
MTLLNISGLS HHYAHGGFNG KHQHQAVLNN VSLTLKSGET VALLGRSGCG KSTLARLLVG LESPAQGNIS WRGEPLAKLN RAQRKAFRRD IQMVFQDSIS AVNPRKTVRE ILREPMRHLL SLKKSEQLAR ASEMLKAVDL DDSVLDKRPP QLSGGQLQRV CLARALAVEP KLLILDEAVS NLDLVLQAGV IRLLKKLQQQ FGTACLFITH DLRLVERFCQ RVMVMDNGQI VETQVVGEKL TFSSDAGRVL QNAVLPAFPV RRRTTEKV |
Length |
268 |
Mol. Wt |
29.721 kDa |
pI |
10.5 (calculated) |
Extinction coefficient |
6,990 - 7,490 (calc based on 1 Y, 1 W, and 4 C residues) |
edit table |
Domains/Motifs/Modification Sites
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
Resource type | Source | Notes/Reference |
---|---|---|
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
ASAP:ABE-0011362 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
EcoCyc:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
Escherichia coli str. K-12 substr. MG1655 | ||
RegulonDB:ECK120001985 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2004 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
---|---|---|---|---|---|---|---|
Protein |
Ecoli K-12 |
3.69+/-0.083 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
mRNA |
Ecoli K-12 |
0.000620347 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
Protein |
E. coli K-12 MG1655 |
13a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
Protein |
E. coli K-12 MG1655 |
5a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
Protein |
E. coli K-12 MG1655 |
0a |
molecules/cell/generation |
|
Ribosome Profiling |
Low confidence in the sequencing data set. |
PMID: 24766808 |
edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:3615779..3615819
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
Allele Name | Mutation | Phenotype | Reference |
---|---|---|---|
edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
Type | Reference | Notes |
---|---|---|
microarray |
NCBI GEO profiles for nikE | |
microarray |
Summary of data for nikE from multiple microarray studies | |
edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
Resource Name | Resource Type | Description | Source | Notes |
---|---|---|---|---|
edit table |
<protect></protect>
Notes
Accessions Related to nikE Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2004 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001985 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0011362 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
Organism | Homologs (Statistics) | Comments |
---|---|---|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
Shigella flexneri |
NIKE |
From SHIGELLACYC |
E. coli O157 |
NIKE |
From ECOO157CYC |
edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
EcoCyc:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
EcoGene:EG12079 |
Escherichia coli str. K-12 substr. MG1655 | |
RegulonDB:ECK120001985 |
Escherichia coli str. K-12 substr. MG1655 | |
EchoBASE:EB2004 |
Escherichia coli str. K-12 substr. MG1655 | |
ASAP:ABE-0011362 |
Escherichia coli str. K-12 substr. MG1655 | |
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
Categories