nhaA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nhaA |
|---|---|
| Mnemonic |
Na+/H+ antiporter |
| Synonyms |
ECK0020, b0019, JW0018, ant, antA, hyc[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.38 minutes |
MG1655: 17489..18655 |
||
|
NC_012967: 17488..18654 |
||||
|
NC_012759: 17489..18655 |
||||
|
W3110 |
|
W3110: 17489..18655 |
||
|
DH10B: 17489..18655 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
17489 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
nhaA(del) (Keio:JW0018) |
deletion |
deletion |
|||||
|
nhaAD163C |
D163C |
Loss of antiport activity |
seeded from UniProt:P13738 | ||||
|
nhaAD163N |
D163N |
Loss of antiport activity. Abolishes ability to grow on high salt medium |
seeded from UniProt:P13738 | ||||
|
nhaAD164N |
D164N |
Loss of antiport activity. Abolishes ability to grow on high salt medium |
seeded from UniProt:P13738 | ||||
|
nhaAH225A |
H225A |
Loss of antiport activity. Abolishes ability to grow at alkaline pH |
seeded from UniProt:P13738 | ||||
|
nhaAH225C,S |
H225C,S |
Slightly reduced antiport activity. No effect on pH sensitivity |
seeded from UniProt:P13738 | ||||
|
nhaAG338S |
G338S |
Loss of pH-sensitivity |
seeded from UniProt:P13738 | ||||
|
nhaAH225D,R |
H225D,R |
Shifts threshold for pH-sensitive inactivation |
seeded from UniProt:P13738 | ||||
|
nhaAD133N |
D133N |
Loss of antiport activity. Abolishes ability to grow on high salt medium |
seeded from UniProt:P13738 | ||||
|
nhaA1(del)::kan |
|||||||
|
nhaA737(del)::kan |
|||||||
|
nhaA(del) nhaR(del) |
Sensitivity to |
Sensitive to Li + |
Strain: OR200 |
||||
|
nhaA(del) |
Sensitivity to |
Sensitivity to Li + |
Table 4A | ||||
|
nhaA multicopy |
Resistant to |
Resistance to Li + |
Strains: OR100/pKR225 and OR200/pKR225 |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0018 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACATCTGCATCGATTCTT Primer 2:CCAACTGATGGACGCAAACGAAC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 53% [10] | ||
|
Linked marker |
est. P1 cotransduction: 59% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Gerchman, Y et al. (1993) Histidine-226 is part of the pH sensor of NhaA, a Na+/H+ antiporter in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 90 1212-6 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Padan, E et al. (1989) Deletion of ant in Escherichia coli reveals its function in adaptation to high salinity and an alternative Na+/H+ antiporter system(s). J. Biol. Chem. 264 20297-302 PubMed
- ↑ Pinner, E et al. (1993) Physiological role of nhaB, a specific Na+/H+ antiporter in Escherichia coli. J. Biol. Chem. 268 1729-34 PubMed
- ↑ 7.0 7.1 7.2 Rahav-Manor, O et al. (1992) NhaR, a protein homologous to a family of bacterial regulatory proteins (LysR), regulates nhaA, the sodium proton antiporter gene in Escherichia coli. J. Biol. Chem. 267 10433-8 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 9.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
