mscL:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
mscL |
|---|---|
| Mnemonic |
Mechanosensitive channel |
| Synonyms |
ECK3277, b3291, JW3252, yhdC[1], stkA, yhdC |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.06 minutes |
MG1655: 3436046..3436456 |
||
|
NC_012967: 3365929..3366339 |
||||
|
NC_012759: 3323203..3323613 |
||||
|
W3110 |
|
W3110: 4202392..4201982 |
||
|
DH10B: 3533791..3534201 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
3436046 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔmscL (Keio:JW3252) |
deletion |
deletion |
|||||
|
ΔmscL727::kan |
|||||||
|
mscL-K31C |
-->TGC |
K31C |
No significant change in pressure sensitivity or open time. |
Parental: AW405 |
See Table 1 | ||
|
mscL-K31R |
-->AGG |
K31R |
No significant change in pressure sensitivity or open time. |
Parental:AW405 |
See table 1 | ||
|
mscL-K31E |
-->GAG |
K31E |
Sensitivity to |
Activation pressure lowered by 18.3 mmHg |
Parental:AW405 |
See table 4 | |
|
mscL-Q56P |
-->CCT |
Q56P |
Sensitivity to |
Pressure |
Parental:AW405 |
see table 1 | |
|
mscL-Q56C |
-->TGC |
Q56C |
Conductance |
Increased channel open time |
Parental: AW405 |
See table 1 | |
|
mscL-Q56F |
-->TTT |
Q56F |
Conductance |
Increased open channel time |
Parental: AW405 |
See table 1 | |
|
mscL-Q56W |
-->TGG |
Q56W |
Conductance |
Increased open channel time |
Parental: AW405 |
see table 1 | |
|
mscL-Q56Y |
-->TAC |
Q56Y |
Conductance |
Increased open channel time |
Parental: AW405 |
See table 1 | |
|
mscL-Q56L |
-->TTA |
Q56L |
No significant change in pressure sensitivity or open time. |
Parental: AW405 |
See table 1 | ||
|
mscL-Q56R |
-->CGT |
Q56R |
Sensitivity to |
Activation pressure lowered by 17.9 mmHg |
Parental: AW405 |
See table 4 | |
|
mscLΔ2-4 |
Deletion |
No significant change in pressure sensitivity or open time. |
Parental: AW405 |
See table 1 | |||
|
mscL-ΔQ56 |
Deletion |
Sensitivity to |
Pressure |
Parental: AW405 |
See table 1 | ||
|
mscLΔ110-136 |
Deletion |
No significant change in pressure sensitivity or open time. |
Parental: AW405 |
See table 1 | |||
|
mscL-Q56H |
-->CAT |
Q56H |
Sensitivity to |
Increased sensitivity to pressure at pH 5 (activation pressure lowered by 18.6 mmHg) and increased open channel time at pH 7.5. |
Parental: AW405 |
See table 1 and table 4 | |
|
mscL-K31D |
-->GAT |
K31D |
Growth Phenotype |
Inhibits growth |
See figure 1 | ||
|
mscL-K31E |
K31E |
Growth Phenotype |
Inhibits growth |
See figure 1 | |||
|
mscLΔ104-136 |
Deletion |
Conductance |
Failed to exhibit functional channel |
See table 2 | |||
|
mscLΔEV |
Internal deletion (Δ41-61) |
Conductance |
Failed to show functional channels |
See table 2 | |||
|
mscLNBE |
Deletion (Δ1-8) |
Conductance |
Decreased conductance |
See table 2 | |||
|
mscL-G22R |
G22R |
Growth Phenotype |
Growth inhibited and pressure threshold lowered. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22K |
G22K |
Growth Phenotype |
Growth inhibited and pressure threshold lowered. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22D |
G22D |
Growth Phenotype |
Growth inhibited and pressure threshold lowered. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22E |
G22D |
Growth Phenotype |
Growth inhibited and pressure threshold lowered. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22S |
G22S |
Growth Phenotype |
Growth decreased and pressure threshold lowered. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22Y |
G22Y |
Growth Phenotype |
Growth decreased |
Parental plasmid: pb10b |
See figure 1a and table 1 | ||
|
mscL-G22Q |
G22Q |
Growth Phenotype |
Growth decreased and pressure threshold lowered. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22T |
G22T |
Growth Phenotype |
Growth decreased and pressure threshold lowered |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22V |
G22V |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1 | ||
|
mscL-G22L |
G22L |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22W |
G22W |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22F |
G22F |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G11I |
G22I |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22M |
G22M |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22C |
G22C |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
|
mscL-G22P |
G22P |
Resistant to |
Pressure threshold increased. No change in growth. |
Parental plasmid: pb10b |
See figure 1a and table 1. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3252 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCATTATTAAAGAATTTCG Primer 2:CCAGAGCGGTTATTCTGCTCTTT | |
|
Linked marker |
est. P1 cotransduction: 78% [11] | ||
|
Linked marker |
est. P1 cotransduction: 2% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Sukharev, SI et al. (1994) A large-conductance mechanosensitive channel in E. coli encoded by mscL alone. Nature 368 265-8 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 Blount, P et al. (1996) Single residue substitutions that change the gating properties of a mechanosensitive channel in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 93 11652-7 PubMed
- ↑ 6.0 6.1 6.2 Gu, L et al. (1998) Electromechanical coupling model of gating the large mechanosensitive ion channel (MscL) of Escherichia coli by mechanical force. Biophys. J. 74 2889-902 PubMed
- ↑ 7.0 7.1 Blount, P et al. (1997) Mutations in a bacterial mechanosensitive channel change the cellular response to osmotic stress. J. Biol. Chem. 272 32150-7 PubMed
- ↑ 8.0 8.1 8.2 Häse, CC et al. (1997) Molecular dissection of the large mechanosensitive ion channel (MscL) of E. coli: mutants with altered channel gating and pressure sensitivity. J. Membr. Biol. 157 17-25 PubMed
- ↑ 9.00 9.01 9.02 9.03 9.04 9.05 9.06 9.07 9.08 9.09 9.10 9.11 9.12 9.13 9.14 9.15 Yoshimura, K et al. (1999) Hydrophilicity of a single residue within MscL correlates with increased channel mechanosensitivity. Biophys. J. 77 1960-72 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
