moaE:Gene

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

<protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

moaE

Mnemonic

Molybdenate

Synonyms

ECK0774, b0785, JW0768, chlA5[1]

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

17.64 minutes 

MG1655: 818518..818970
<gbrowseImage> name=NC_000913:818518..818970 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 811921..812373
<gbrowseImage> name=NC_012967:811921..812373 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 721486..721938
<gbrowseImage> name=NC_012759:721486..721938 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 819717..820169
<gbrowseImage> name=NC_007779:819717..820169 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 872446..872898
<gbrowseImage> name=NC_010473:872446..872898 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

818521

Edman degradation

PMID:8361352[2]
PMID:8514782[3]


<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔmoaE (Keio:JW0768)

deletion

deletion

PMID:16738554[4]

Shigen
CGSC8825[5]

ΔmoaE757::kan

PMID:16738554[4]

CGSC:101906


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0768

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCGCAGAAACCAAAATTGTTGT

Primer 2:CCCCAGCGTTTTGCCGCCTGCTG

3D4

Kohara Phage

Genobase

PMID:3038334[7]

24F9

Kohara Phage

Genobase

PMID:3038334[7]

nadA57::Tn10

Linked marker

CAG12147 = CGSC7351[5]

est. P1 cotransduction: 19% [8]

zbh-29::Tn10

Linked marker

CAG18493 = CGSC7353[5]

est. P1 cotransduction: 92% [8]
Synonyms:zbi-29::Tn10

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11598

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11598

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001546

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945399

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1555

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002678

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Rivers, SL et al. (1993) Molecular genetic analysis of the moa operon of Escherichia coli K-12 required for molybdenum cofactor biosynthesis. Mol. Microbiol. 8 1071-81 PubMed
  3. Pitterle, DM & Rajagopalan, KV (1993) The biosynthesis of molybdopterin in Escherichia coli. Purification and characterization of the converting factor. J. Biol. Chem. 268 13499-505 PubMed
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories