lpxD:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lpxD |
|---|---|
| Mnemonic |
Lipid A expression/biosynthesis |
| Synonyms |
ECK0178, b0179, JW0174, fir, firA, hlpA[1], ssc, omsA, osmA[2][3] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.33 minutes |
MG1655: 200971..201996 |
||
|
NC_012967: 203813..204838 |
||||
|
NC_012759: 200970..201995 |
||||
|
W3110 |
|
W3110: 200971..201996 |
||
|
DH10B: 175075..176100 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
200974 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
lpxDQ165R |
Q165R |
In firA200; confer temperature sensitivity and reverses the rifampicin resistance of rpoB mutants |
seeded from UniProt:P21645 | ||||
|
lpxDI172F |
I172F |
In firA201; confer temperature sensitivity |
seeded from UniProt:P21645 | ||||
|
lpxDG228D |
G228D |
In firA200 and firA201; confer temperature sensitivity |
seeded from UniProt:P21645 | ||||
|
lpxDG252S |
G252S |
In firA200 and firA201; confer temperature sensitivity |
seeded from UniProt:P21645 | ||||
|
lpxDS271N |
S271N |
In omsA; confer temperature sensitivity |
seeded from UniProt:P21645 | ||||
|
lpxD36(ts) |
temperature sensitive |
||||||
|
lpxD200(ts) |
temperature sensitive |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0174 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCCTTCAATTCGACTGGCTGA Primer 2:CCGTCTTGTTGATTAACCTTGCG | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 8% [9] | ||
|
Linked marker |
est. P1 cotransduction: 30% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Dicker, IB & Seetharam, S (1991) Cloning and nucleotide sequence of the firA gene and the firA200(Ts) allele from Escherichia coli. J. Bacteriol. 173 334-44 PubMed
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Platko, JV et al. (1990) The ilvIH operon of Escherichia coli is positively regulated. J. Bacteriol. 172 4563-70 PubMed
- ↑ Lathe, R et al. (1980) Prokaryotic histone-like protein interacting with RNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 77 3548-52 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
