lpxC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lpxC |
|---|---|
| Mnemonic |
Lipid A expression/biosynthesis |
| Synonyms |
ECK0097, b0096, JW0094, asmB, envA[1], envA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
2.3 minutes |
MG1655: 106557..107474 |
||
|
NC_012967: 109361..110278 |
||||
|
NC_012759: 106556..107473 |
||||
|
W3110 |
|
W3110: 106557..107474 |
||
|
DH10B: 80661..81578 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
106557 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
lpxCF50S |
F50S |
(in ASMB2/3; reduced activity) |
Strain variation; seeded from UniProt:P0A725 | ||||
|
lpxCG210S |
G210S |
(in ASMB1; reduced activity) |
Strain variation; seeded from UniProt:P0A725 | ||||
|
lpxC101 |
C to T |
His19Tyr |
Cell Shape |
Septation is inhibited forming chains of cells. Shows increased sensitivity to certain antibiotics. |
Same as envA1 first described by S. Normark et al., PMID:4887513[5]. | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0094 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATCAAACAAAGGACACTTAA Primer 2:CCTGCCAGTACAGCTGAAGGCGC | |
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 42% [9] | |
|
Linked marker |
est. P1 cotransduction: 16% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Young, K et al. (1995) The envA permeability/cell division gene of Escherichia coli encodes the second enzyme of lipid A biosynthesis. UDP-3-O-(R-3-hydroxymyristoyl)-N-acetylglucosamine deacetylase. J. Biol. Chem. 270 30384-91 PubMed
- ↑ 3.0 3.1 Kloser, AW et al. (1996) asmB, a suppressor locus for assembly-defective OmpF mutants of Escherichia coli, is allelic to envA (lpxC). J. Bacteriol. 178 5138-43 PubMed
- ↑ Beall, B & Lutkenhaus, J (1987) Sequence analysis, transcriptional organization, and insertional mutagenesis of the envA gene of Escherichia coli. J. Bacteriol. 169 5408-15 PubMed
- ↑ 5.0 5.1 Normark, S et al. (1969) Mutant of Escherichia coli with anomalous cell division and ability to decrease episomally and chromosomally mediated resistance to ampicillin and several other antibiotics. J. Bacteriol. 97 1334-42 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
