lpp:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
lpp |
|---|---|
| Mnemonic |
Lipoprotein |
| Synonyms |
ECK1673, b1677, JW1667, mlpA, mulI[1], mulI |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
37.84 minutes |
MG1655: 1755445..1755681 |
||
|
NC_012967: 1734688..1734924 |
||||
|
NC_012759: 1647504..1647740 |
||||
|
W3110 |
|
W3110: 1759135..1759371 |
||
|
DH10B: 1846016..1846252 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
1755505 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δlpp (Keio:JW1667) |
deletion |
deletion |
|||||
|
lpp::Tn5KAN-2 (FB20422) |
Insertion at nt 92 in Plus orientation |
contains pKD46 | |||||
|
lpp::Tn5KAN-2 (FB20423) |
Insertion at nt 100 in Plus orientation |
does not contain pKD46 | |||||
|
lppS22D |
S22D |
Localizes to the inner membrane, where it associates with peptidoglycan, thereby preventing separation of the two membranes. Prolonged expression is lethal for the cell |
seeded from UniProt:P69776 | ||||
|
lppR77D,L |
R77D,L |
Reduces the formation of murein- bound lipoprotein |
seeded from UniProt:P69776 | ||||
|
lppK78R |
K78R |
Abolishes the formation of murein- bound lipoprotein |
seeded from UniProt:P69776 | ||||
|
lppY76F,H,I,L |
Y76F,H,I,L |
Does not affect the formation of murein-bound lipoprotein |
seeded from UniProt:P69776 | ||||
|
lppD70E,G,S |
D70E,G,S |
Does not affect the formation of murein-bound lipoprotein |
seeded from UniProt:P69776 | ||||
|
lppK75S,T |
K75S,T |
Does not affect the formation of murein-bound lipoprotein |
seeded from UniProt:P69776 | ||||
|
lppY76C,D,E,G,N,P,S |
Y76C,D,E,G,N,P,S |
Reduces the formation of murein-bound lipoprotein |
seeded from UniProt:P69776 | ||||
|
lpp-3 |
|||||||
|
lpp-6 |
|||||||
|
lpp-1 |
|||||||
|
Δlpp-254 |
|||||||
|
lpp-21 |
|||||||
|
lpp-5508 |
|||||||
|
Δlpp-752::kan |
| ||||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1667 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAGCTACTAAACTGGTACT Primer 2:CCCTTGCGGTATTTAGTAGCCAT | |
|
Linked marker |
est. P1 cotransduction: % [10] | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 45% [10] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Inouye, S et al. (1977) Amino acid sequence for the peptide extension on the prolipoprotein of the Escherichia coli outer membrane. Proc. Natl. Acad. Sci. U.S.A. 74 1004-8 PubMed
- ↑ Braun, V & Bosch, V (1972) Sequence of the murein-lipoprotein and the attachment site of the lipid. Eur. J. Biochem. 28 51-69 PubMed
- ↑ Hantke, K & Braun, V (1973) Covalent binding of lipid to protein. Diglyceride and amide-linked fatty acid at the N-terminal end of the murein-lipoprotein of the Escherichia coli outer membrane. Eur. J. Biochem. 34 284-96 PubMed
- ↑ 5.0 5.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 6.0 6.1 6.2 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed
- ↑ Strauch, KL & Beckwith, J (1988) An Escherichia coli mutation preventing degradation of abnormal periplasmic proteins. Proc. Natl. Acad. Sci. U.S.A. 85 1576-80 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
