lpoB:On One Page

From EcoliWiki
Jump to: navigation, search

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

<protect>

Standard Name

lpoB

Gene Synonym(s)

ycfM, ECK1091, b1105, JW5157[1], JW5157

Product Desc.

predicted protein[2][3]

Novel verified lipoprotein, function unknown[4]

Product Synonyms(s)

predicted outer membrane lipoprotein[1], YcfM[2][1], B1105[2][1] , LpoB, ECK1091, JW5157, b1105

Function from GO

<GO_nr />

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): hinT[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]


First 19 aa are a type II signal peptide. The TTG at codon -1 or the ATG at codon +4 could be the true start codon.[4]



Gene

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

lpoB

Mnemonic

Systematic nomenclature

Synonyms

ycfM, ECK1091, b1105, JW5157[1], JW5157

</protect>

Notes

Location(s) and DNA Sequence

[back to top]


<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

25.04 minutes 

MG1655: 1161861..1162502
<gbrowseImage> name=NC_000913:1161861..1162502 source=MG1655 preset=GeneLocation </gbrowseImage>

REL606

NC_012967: 1177207..1177848
<gbrowseImage> name=NC_012967:1177207..1177848 source=REL606 preset=GeneLocation </gbrowseImage>

BW2952

NC_012759: 1065786..1066427
<gbrowseImage> name=NC_012759:1065786..1066427 source=BW2952 preset=GeneLocation </gbrowseImage>

W3110

 

W3110: 1164215..1164856
<gbrowseImage> name=NC_007779:1164215..1164856 source=W3110 preset=GeneLocation </gbrowseImage>

DH10B

DH10B: 1217306..1217947
<gbrowseImage> name=NC_010473:1217306..1217947 source=DH10B preset=GeneLocation </gbrowseImage>

</protect>

Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

<protect></protect>

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔycfM (Keio:JW5157)

deletion

deletion

PMID:16738554

Shigen
CGSC11212[5]

ΔycfM767::kan

PMID:16738554

CGSC:104002


<protect></protect>

Notes

Genetic Interactions

[back to top]


<protect>

Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

</protect>

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW5157

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCACAAAAATGAGTCGCTACGC

Primer 2:CCTTGCTGCGAAACGGCACCTTT

zce-726::Tn10

Linked marker

CAG12078 = CGSC7361[5]

est. P1 cotransduction: 80% [6]

zcf-117::Tn10

Linked marker

CAG18463 = CGSC7363[5]

est. P1 cotransduction: 10% [6]

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G6565

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13431

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003161

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948536

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3205

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003733

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Product(s)

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

LpoB

Synonyms

predicted outer membrane lipoprotein[1], YcfM[2][1], B1105[2][1] , LpoB, ECK1091, JW5157, b1105

Product description

predicted protein[2][3]

Novel verified lipoprotein, function unknown[4]

EC number (for enzymes)


<protect></protect>

Notes

Function

[back to top]


<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Outer membrane

PMID:15174130

EchoLocation:ycfM


<protect></protect>

Notes

Structure and Physical Properties

[back to top]


<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MTKMSRYALI TALAMFLAGC VGQREPAPVE EVKPAPEQPA EPQQPVPTVP SVPTIPQQPG
PIEHEDQTAP PAPHIRHYDW NGAMQPMVSK MLGADGVTAG SVLLVDSVNN RTNGSLNAAE
ATETLRNALA NNGKFTLVSA QQLSMAKQQL GLSPQDSLGT RSKAIGIARN VGAHYVLYSS
ASGNVNAPTL QMQLMLVQTG EIIWSGKGAV SQQ
Length

213

Mol. Wt

22.514 kDa

pI

6.9 (calculated)

Extinction coefficient

16,960 - 17,085 (calc based on 4 Y, 2 W, and 1 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=ycfM taxon=562,83333 </beststructure>

Models

View models at:

</protect>

Structure figures

<protect>

</protect>

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

<protect></protect>

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129068

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:948536

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003733

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0AB38

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G6565

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG13431

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003161

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:948536

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3205

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]




Expression

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MC4100

4.53E+02

molecules/cell

  • Medium: median data from rich and minimal media
  • Temperature (°C): 37
  • Doubling time (min): Growth Rate(min):
  • Growth phase: other:

emPAI

PMID:18304323

Protein

E. coli K-12 MG1655

1490

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

954

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

872

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


<protect>

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

hinT

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


<protect><gbrowseImage> name=NC_000913:1161841..1161881 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1105 (EcoliWiki Page)

NCBI GEO profiles for ycfM

microarray

GenExpDB:b1105 (EcoliWiki Page)

Summary of data for ycfM from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

<protect></protect>

Notes

Accessions Related to ycfM Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G6565

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3205

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1105

EcoGene

EcoGene:EG13431

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003161

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003733

Escherichia coli str. K-12 substr. MG1655

<protect></protect>

Notes

Links

[back to top]



Evolution

[back to top]


{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Shigella flexneri

YCFM

From SHIGELLACYC

E. coli O157

YCFM

From ECOO157CYC

<protect></protect>

Notes

Families

[back to top]


<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database Accession Notes

</protect> <protect></protect>

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]