ileS:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ileS |
|---|---|
| Mnemonic |
Isoleucine |
| Synonyms |
ECK0027, b0026, JW0024, ilvS[1], ilvS |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.48 minutes |
MG1655: 22391..25207 |
||
|
NC_012967: 26463..29279 |
||||
|
NC_012759: 22391..25207 |
||||
|
W3110 |
|
W3110: 22391..25207 |
||
|
DH10B: 22391..25207 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
22394 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ileSG94R |
G94R |
6000-fold increase in Km for isoleucine and 4-fold increase in Km for ATP, with no effect on activity |
seeded from UniProt:P00956 | ||||
|
ileST243R |
T243R |
Abolishes pretransfer editing |
seeded from UniProt:P00956 | ||||
|
ileST246A |
T246A |
Nearly the same editing activity as the wild-type |
seeded from UniProt:P00956 | ||||
|
ileST241A |
T241A |
Nearly the same editing activity as the wild-type |
seeded from UniProt:P00956 | ||||
|
ileST242A |
T242A |
Abolishes editing activity against valine, with little change in aminoacylation activity; when associated with A-250 |
seeded from UniProt:P00956 | ||||
|
ileST242P |
T242P |
Abolishes editing activity against valine, with little change in aminoacylation activity |
seeded from UniProt:P00956 | ||||
|
ileST243A |
T243A |
Abolishes editing activity against valine, with little change in aminoacylation activity |
seeded from UniProt:P00956 | ||||
|
ileSW421A |
W421A |
Abolishes translocation from the aminoacylation site to the editing site, without effect on aminoacylation activity and posttransfer editing; when associated with A-183 |
seeded from UniProt:P00956 | ||||
|
ileSN250A |
N250A |
Abolishes editing activity against valine, with little change in aminoacylation activity |
seeded from UniProt:P00956 | ||||
|
ileSH333A |
H333A |
Alters the specificity for hydrolysis of the aminoacyl tRNA ester, with no effect on pretransfer editing |
seeded from UniProt:P00956 | ||||
|
ileSD342A,N |
D342A,N |
Strong decrease in total editing and deacylation activities. Severely deficient in translocation from the aminoacylation site to the editing site |
seeded from UniProt:P00956 | ||||
|
ileSD342E |
D342E |
Reduces 2- to 3-fold the total editing activity and 2-fold the deacylation activity. Moderately reduces translocation from the aminoacylation site to the editing site |
seeded from UniProt:P00956 | ||||
|
ileSK183A |
K183A |
Abolishes translocation from the aminoacylation site to the editing site, without effect on aminoacylation activity and posttransfer editing; when associated with A-421 |
seeded from UniProt:P00956 | ||||
|
ileSC97S |
C97S |
No effect on activity |
seeded from UniProt:P00956 | ||||
|
ileSF594L |
F594L |
(in strain: PS102) |
Strain variation; seeded from UniProt:P00956 | ||||
|
ileSI102N |
I102N |
No significant effect on activity |
seeded from UniProt:P00956 | ||||
|
ileS1 |
| ||||||
| edit table |
<protect></protect>
Notes
The Keio collection[5] lists a deletion of ileS. The insertion in this strain is a duplication of the ileS region.[6] IleS is the only Ile-aminoacyl tRNA synthetase in the genome.
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0024 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTGACTATAAATCAACCCT Primer 2:CCGGCAAACTTACGTTTTTCACC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 44% [10] | ||
|
Linked marker |
est. P1 cotransduction: 71% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Webster, T et al. (1984) Specific sequence homology and three-dimensional structure of an aminoacyl transfer RNA synthetase. Science 226 1315-7 PubMed
- ↑ Yanagisawa, T et al. (1994) Relationship of protein structure of isoleucyl-tRNA synthetase with pseudomonic acid resistance of Escherichia coli. A proposed mode of action of pseudomonic acid as an inhibitor of isoleucyl-tRNA synthetase. J. Biol. Chem. 269 24304-9 PubMed
- ↑ Iaccarino, M & Berg, P (1971) Isoleucine auxotrophy as a consequence of a mutationally altered isoleucyl-transfer ribonucleic acid synthetase. J. Bacteriol. 105 527-37 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
