iaaA:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
iaaA |
|---|---|
| Gene Synonym(s) |
ECK0818, b0828, JW0812, spt, ybiK[1], ybiK |
| Product Desc. |
Component of asparaginase III α-β complex[3]; asparaginase III[3] isoAsp aminopeptidase, cleaves isoAsp-X dipeptides, Ntn hydrolase, weak L-asparaginase activity in vitro (EcAIII), precursor is cleaved into an alpha and beta subunit[4] heterotetrameric, glutathione utilization[5] |
| Product Synonyms(s) |
L-asparaginase[1], B0828[2][1], Spt[2][1], YbiK[2][1] , ECK0818, JW0812, spt, ybiK, b0828 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links |
|
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
E. coli IaaA is cleaved before Thr179 to expose an N-terminal nucleophile and to produce two subunits.[4] CysB regulon, sensitive to cysteine repression. The start of the Salmonella IaaA is confirmed by N-terminal sequencing of the IaaA precursor. Salmonella IaaA has been shown to have isoaspartyl-tripeptidase activity.[6] E. coli probably also has tripeptidase activity.[5] iaaA is a non-essential gene.[5]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
iaaA |
|---|---|
| Mnemonic |
Isoaspartyl Aminopeptidase; EcAIII |
| Synonyms |
ECK0818, b0828, JW0812, spt, ybiK[1], ybiK |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
18.66 minutes |
MG1655: 865791..866756 |
||
|
NC_012967: 859120..860085 |
||||
|
NC_012759: 768759..769724 |
||||
|
W3110 |
|
W3110: 866990..867955 |
||
|
DH10B: 919719..920684 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔiaaA (Keio:JW0812) |
deletion |
deletion |
PMID:16738554 |
||||
|
iaaAT179A |
T179A |
Catalytically inactive |
seeded from UniProt:P37595 | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0812 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGGCAAAGCAGTCATTGCAAT Primer 2:CCCTGTGTGGCAACGGTGTCCCC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 14% [8] | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: % [8] | |
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB2307 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0002828 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
IaaA |
|---|---|
| Synonyms |
L-asparaginase[1], B0828[2][1], Spt[2][1], YbiK[2][1] , ECK0818, JW0812, spt, ybiK, b0828 |
| Product description |
Component of asparaginase III α-β complex[3]; asparaginase III[3] isoAsp aminopeptidase, cleaves isoAsp-X dipeptides, Ntn hydrolase, weak L-asparaginase activity in vitro (EcAIII), precursor is cleaved into an alpha and beta subunit[4] heterotetrameric, glutathione utilization[5] |
| EC number (for enzymes) | |
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005737 |
cytoplasm |
PMID:PMID |
NAS: Non-traceable Author Statement |
C |
Seeded from Riley et al 2006 [1]. |
complete | ||
|
Deprecated |
GO:0009063 |
cellular amino acid catabolic process |
PMID:15265041 |
IDA: Inferred from Direct Assay |
P |
See notes for the annotation of IaaA to GO:0006530. |
complete | |
|
GO:0016787 |
hydrolase activity |
PMID:15265041 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0004067 |
asparaginase activity |
PMID:15265041 |
IDA: Inferred from Direct Assay |
F |
See notes for the annotation of IaaA to GO:0006530. |
complete | ||
|
Deprecated |
GO:0006530 |
asparagine catabolic process |
PMID:15265041 |
IDA: Inferred from Direct Assay |
P |
IaaA can hydrolyze asparagine to aspartate + NH3 in vitro, but the affinity for asparagine is lower than that of known bacterial asparaginases, so this activity may not be physiologically relevant.[9] |
complete | |
|
GO:0008798 |
beta-aspartyl-peptidase activity |
GOA:spec |
IEA: Inferred from Electronic Annotation |
EC:3.4.19.5 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0008798 |
beta-aspartyl-peptidase activity |
PMID:15265041 |
IDA: Inferred from Direct Assay |
F |
Table 2 |
complete | ||
|
GO:0005737 |
cytoplasm |
PMID:15946951 |
IC: Inferred by Curator |
C |
Missing: with/from | |||
| edit table |
Interactions
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of asparaginase III α-β complex |
could be indirect |
||
|
Protein |
caiB |
PMID:16606699 |
Experiment(s):EBI-1138145 | |
|
Protein |
moeA |
PMID:16606699 |
Experiment(s):EBI-1138145 | |
|
Protein |
yfiR |
PMID:16606699 |
Experiment(s):EBI-1138145 | |
|
Protein |
Subunits of asparaginase III |
could be indirect |
| |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MRITIILVAP ARAENIGAAA RAMKTMGFSD LRIVDSQAHL EPATRWVAHG SGDIIDNIKV FPTLAESLHD VDFTVATTAR SRAKYHYYAT PVELVPLLEE KSSWMSHAAL VFGREDSGLT NEELALADVL TGVPMVADYP SLNLGQAVMV YCYQLATLIQ QPAKSDATAD QHQLQALRER AMTLLTTLAV ADDIKLVDWL QQRLGLLEQR DTAMLHRLLH DIEKNITK |
| Length |
228 |
| Mol. Wt |
25.259 kDa |
| pI |
5.9 (calculated) |
| Extinction coefficient |
25,440 - 25,565 (calc based on 6 Y, 3 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0002828 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120002269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2307 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli K-12 MG1655 |
74 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
257 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
809 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
 Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:865771..865811
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for iaaA | |
|
microarray |
Summary of data for iaaA from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (865502..865793) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
<protect></protect>
Notes
Accessions Related to iaaA Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2307 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0002828 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
YBIK |
From SHIGELLACYC |
|
E. coli O157 |
Z1052 |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG12407 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120002269 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB2307 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0002828 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 Borek, D et al. (2004) Expression, purification and catalytic activity of Lupinus luteus asparagine beta-amidohydrolase and its Escherichia coli homolog. Eur. J. Biochem. 271 3215-26 PubMed
- ↑ 5.0 5.1 5.2 5.3 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Larsen, RA et al. (2001) Aspartic peptide hydrolases in Salmonella enterica serovar typhimurium. J. Bacteriol. 183 3089-97 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Michalska, K et al. (2005) Crystal structure of isoaspartyl aminopeptidase in complex with L-aspartate. J. Biol. Chem. 280 28484-91 PubMed
- ↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed
Categories
- Genes in OpenBioSystems with Promoter Fusions
- Genes with homologs in Anopheles gambiae
- Genes with homologs in Apis mellifera
- Genes with homologs in Arabidopsis thaliana
- Genes with homologs in Bos taurus
- Genes with homologs in Caenorhabditis briggsae
- Genes with homologs in Caenorhabditis elegans
- Genes with homologs in Canis familiaris
- Genes with homologs in Ciona intestinalis
- Genes with homologs in Danio rerio
- Genes with homologs in Dictyostelium discoideum
- Genes with homologs in Drosophila melanogaster
- Genes with homologs in Drosophila pseudoobscura
- Genes with homologs in Gallus gallus
- Genes with homologs in Homo sapiens
- Genes with homologs in Macaca mulatta
- Genes with homologs in Monodelphis domestica
- Genes with homologs in Mus musculus
- Genes with homologs in Pan troglodytes
- Genes with homologs in Rattus norvegicus
- Genes with homologs in Schizosaccharomyces pombe
- Genes with homologs in Takifugu rubripes
- Genes with homologs in Tetraodon nigroviridis
- Genes with homologs in Xenopus tropicalis
- Genes with homologs in Shigella flexneri
- Genes with homologs in E. coli O157
