gapA:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
gapA |
---|---|
Mnemonic |
Glyceraldehyde phosphate dehydrogenase |
Synonyms | |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
40.11 minutes |
MG1655: 1860795..1861790 |
||
NC_012967: 1840000..1840995 |
||||
NC_012759: 1752854..1753849 |
||||
W3110 |
|
W3110: 1864485..1865480 |
||
DH10B: 1951366..1952361 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
1860798 |
Edman degradation |
PMID:8740179[3] |
| |
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
gapAY43I |
Y43I |
(in strain: ECOR 70) |
Strain variation; seeded from UniProt:P0A9B2 | ||||
gapAG266D |
G266D |
(in strain: E830587) |
Strain variation; seeded from UniProt:P0A9B2 | ||||
gapAE267A |
E267A |
(in strain: E2666-74) |
Strain variation; seeded from UniProt:P0A9B2 | ||||
gapAH177N |
H177N |
Reduces activity about 50-fold |
seeded from UniProt:P0A9B2 | ||||
gapA3 |
|||||||
gapA2(Unst) |
|||||||
gapA7(ts) |
temperature sensitive |
||||||
gapA1(Unst) |
|||||||
gapA5(ts) |
temperature sensitive |
||||||
ΔgapA12::Cm |
|||||||
gapA10::Tn10 |
| ||||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW1768 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACTATCAAAGTAGGTATCAA Primer 2:CCTTTGGAGATGTGAGCGATCAG | |
Kohara Phage |
|||
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 34% [12] | ||
Linked marker |
est. P1 cotransduction: 74% [12] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Pasquali, C et al. (1996) Two-dimensional gel electrophoresis of Escherichia coli homogenates: the Escherichia coli SWISS-2DPAGE database. Electrophoresis 17 547-55 PubMed
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ Tonella, L et al. (1998) '98 Escherichia coli SWISS-2DPAGE database update. Electrophoresis 19 1960-71 PubMed
- ↑ Lacourciere, GM et al. (2002) Direct detection of potential selenium delivery proteins by using an Escherichia coli strain unable to incorporate selenium from selenite into proteins. Proc. Natl. Acad. Sci. U.S.A. 99 9150-3 PubMed
- ↑ Seta, FD et al. (1997) Characterization of Escherichia coli strains with gapA and gapB genes deleted. J. Bacteriol. 179 5218-21 PubMed
- ↑ Ganter, C & Plückthun, A (1990) Glycine to alanine substitutions in helices of glyceraldehyde-3-phosphate dehydrogenase: effects on stability. Biochemistry 29 9395-402 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 CGSC: The Coli Genetics Stock Center
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).