ftsL:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
ftsL |
|---|---|
| Gene Synonym(s) |
ECK0084, b0083, JW0081, yabD, mraR[1], mraR |
| Product Desc. |
essential cell division protein FtsL[2][3] Cell division and growth, membrane protein[4] Localizes proteins to septal machinery during cell division. [5] |
| Product Synonyms(s) |
membrane bound cell division protein at septum containing leucine zipper motif[1], B0083[2][1], YabD[2][1], MraR[2][1], FtsL[2][1] , ECK0084, JW0081, mraR, yabD, b0083 |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): mraZW-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
The ftsL gene is essential. FtsL forms a complex with FtsB prior to mid-cell localization; this complex formation requires FtsQ, but not FtsK. Divisome.[4]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsL |
|---|---|
| Mnemonic |
Filamentation, temperature sensitive |
| Synonyms |
ECK0084, b0083, JW0081, yabD, mraR[1], mraR |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
1.96 minutes |
MG1655: 91032..91397 |
||
|
NC_012967: 93836..94201 |
||||
|
NC_012759: 91031..91396 |
||||
|
W3110 |
|
W3110: 91032..91397 |
||
|
DH10B: 65136..65501 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
mraR33 |
G to A |
glu to lys at amino acid 88 |
Growth Phenotype |
thermosensitive lysis and filamentation of rod cells resulting from a defect in cell growth |
PMID:1447153 PMID:2676977 |
mraR33=lts-33 | |
|
mraR36 |
Guanine to adenine. in putative ATG start codon |
Initial methionine codon changed to isoleucine codon |
Growth Phenotype |
thermosensitive cell lysis and filamentation resulting from inhibition of cell division; at lower cell density more pronounced thermosensitive growth was observed |
PMID:1447153 PMID:2676977 |
mraR36=fts-36 | |
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0081 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCATCAGCAGAGTGACAGAAGC Primer 2:CCTTTTTGCACTACGATATTTTC | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 78% [7] | |
|
Linked marker |
est. P1 cotransduction: 6% [7] | ||
|
pLMG180 |
Plasmid Clone |
ftsL gene cloned pBAD18 |
|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001074 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1078 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000306 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
FtsL |
|---|---|
| Synonyms |
membrane bound cell division protein at septum containing leucine zipper motif[1], B0083[2][1], YabD[2][1], MraR[2][1], FtsL[2][1] , ECK0084, JW0081, mraR, yabD, b0083 |
| Product description |
essential cell division protein FtsL[2][3] Cell division and growth, membrane protein[4] Localizes proteins to septal machinery during cell division. [5] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Periplasmic domain integrity is essential for FtsL to perform accurately. [8]
FtsL forms a ring, similar to FtsZ ring, when it localizes to septum. [9]
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005886 |
plasma membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-1003 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007049 |
cell cycle |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007082 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007049 |
cell cycle |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011922 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0007049 |
cell cycle |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0131 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016020 |
membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR007082 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011922 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-9906 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051301 |
cell division |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR011922 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0051301 |
cell division |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0132 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
rplD |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
|
Protein |
rluA |
PMID:19402753 |
LCMS(ID Probability):99.6 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
From EcoCyc[3] |
|||
|
Inner membrane |
PMID:1332942 |
Membrane anchored | ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MISRVTEALS KVKGSMGSHE RHALPGVIGD DLLRFGKLPL CLFICIILTA VTVVTTAHHT RLLTAQREQL VLERDALDIE WRNLILEENA LGDHSRVERI ATEKLQMQHV DPSQENIVVQ K |
| Length |
121 |
| Mol. Wt |
13.626 kDa |
| pI |
6.9 (calculated) |
| Extinction coefficient |
5,500 - 5,750 (calc based on 0 Y, 1 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0000306 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001074 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1078 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
E. coli LMG83, LMG145, LMG142 (see table 1) |
20 - 40 |
molecules/cell |
|
enzyme activity |
A chromosomal FtsL-phoA (alkaline phosphatase) fusion was assayed for AP activity & shown to be relatively comparable to the previously reported activity/concentration of FtsQ-phoA estimated at 20-40 molecules per cell (reported by Carson et al., PMID:2007547). |
PMID:1332942 |
|
Protein |
E. coli K-12 MG1655 |
416 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
201 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
423 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:91012..91052
source=MG1655
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for ftsL | |
|
microarray |
Summary of data for ftsL from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to ftsL Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1078 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001074 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000306 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
FTSL |
From SHIGELLACYC |
|
E. coli O157 |
FTSL |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11086 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001074 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1078 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0000306 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 Blencowe, DK et al. (2011) Identification of a novel function for the FtsL cell division protein from Escherichia coli K12. Biochem. Biophys. Res. Commun. 411 44-9 PubMed
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Ghigo, JM & Beckwith, J (2000) Cell division in Escherichia coli: role of FtsL domains in septal localization, function, and oligomerization. J. Bacteriol. 182 116-29 PubMed
- ↑ Ghigo, JM et al. (1999) Localization of FtsL to the Escherichia coli septal ring. Mol. Microbiol. 31 725-37 PubMed
Categories


