ftsI:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ftsI |
|---|---|
| Mnemonic |
Filamentation, temperature sensitive |
| Synonyms |
ECK0085, b0084, JW0082, pbpB, sep[1], sep |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
1.97 minutes |
MG1655: 91413..93179 |
||
|
NC_012967: 94217..95983 |
||||
|
NC_012759: 91412..93178 |
||||
|
W3110 |
|
W3110: 91413..93179 |
||
|
DH10B: 65517..67283 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ftsIS307A,T |
S307A,T |
Unable to bind penicillin |
seeded from UniProt:P0AD68 | ||||
|
ftsIS307C |
S307C |
Still able to bind penicillin |
seeded from UniProt:P0AD68 | ||||
|
ftsIN361S |
N361S |
In PBPBR1; obtained after selection for increased resistance to cephalexin, causes a change in the shape of the cell: The polar caps are pointed |
seeded from UniProt:P0AD68 | ||||
|
ftsI23(ts) |
TAC to GAC |
Y380D |
Growth Phenotype |
at non-permissive temperature filaments with indented morphology were formed |
|||
|
ftsI2158(ts) |
Growth Phenotype |
filaments form at 42C |
part of AX655 strain | ||||
|
pbpB2158 |
temperature shift to 42 C caused blunt constrictions |
a shift back to permissive temperature results in aberrant constrictions and formation of minicell-like cells | |||||
|
ftsI372 (Ts) |
Pro-372 to Leu |
Growth Phenotype |
after 2 hours at 42C filamentation occurs and amount of PMP3 was significantly reduced |
| |||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0082 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAGCAGCGGCGAAAACGCA Primer 2:CCCGATCTGCCACCTGTCCCCTC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 77% [10] | |
|
Linked marker |
est. P1 cotransduction: 6% [10] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Addinall, SG et al. (1996) FtsZ ring formation in fts mutants. J. Bacteriol. 178 3877-84 PubMed
- ↑ Allen, JS et al. (1974) Regulation of bacterial cell division: genetic and phenotypic analysis of temperature-sensitive, multinucleate, filament-forming mutants of Escherichia. J. Bacteriol. 117 978-86 PubMed
- ↑ Fletcher, G et al. (1978) Identification of the Escherichia coli cell division gene sep and organization of the cell division-cell envelope genes in the sep-mur-ftsA-envA cluster as determined with specialized transducing lambda bacteriophages. J. Bacteriol. 133 91-100 PubMed
- ↑ Taschner, PE et al. (1988) Division behavior and shape changes in isogenic ftsZ, ftsQ, ftsA, pbpB, and ftsE cell division mutants of Escherichia coli during temperature shift experiments. J. Bacteriol. 170 1533-40 PubMed
- ↑ Begg, KJ et al. (1992) Escherichia coli mutant Y16 is a double mutant carrying thermosensitive ftsH and ftsI mutations. J. Bacteriol. 174 2416-7 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 9.0 9.1 CGSC: The Coli Genetics Stock Center
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
