dnaN:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
dnaN |
---|---|
Mnemonic |
DNA |
Synonyms |
ECK3693, b3701, JW3678[1], JW3678 |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
83.61 minutes |
MG1655: 3880344..3879244 |
||
NC_012967: 3842682..3841582 |
||||
NC_012759: 3767577..3768677 |
||||
W3110 |
|
W3110: 3758094..3759194 |
||
DH10B: 3977928..3976828 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
3879244 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
dnaN59 |
Sensitivity to |
Enhanced UV sensitivity |
Other repair phenotypes also described in PMID:15466025[3] | ||||
dnaN159(ts) |
G66Q, G174A |
temperature sensitive |
|||||
dnaA(N346D) |
N346D |
Suppressor of redox defective multiple mutation |
|||||
dnaN159(ts) |
G66Q, G174A |
temperature sensitive |
|||||
dnaN(G157C) |
G157C |
replication |
under initiation of DNA replication |
||||
dnaN159 |
requires PolI for viability |
| |||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW3678 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAATTTACCGTAGAACGTGA Primer 2:CCaAGTCTCATTGGCATGACAAC | |
Kohara Phage |
|||
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 84% [9] | |
Linked marker |
est. P1 cotransduction: 9% [9] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Katayama, T et al. (1998) The initiator function of DnaA protein is negatively regulated by the sliding clamp of the E. coli chromosomal replicase. Cell 94 61-71 PubMed
- ↑ 3.0 3.1 3.2 Sutton, MD (2004) The Escherichia coli dnaN159 mutant displays altered DNA polymerase usage and chronic SOS induction. J. Bacteriol. 186 6738-48 PubMed
- ↑ Feeney, MA et al. (2012) Mutations at several loci cause increased expression of ribonucleotide reductase in Escherichia coli. J. Bacteriol. 194 1515-22 PubMed
- ↑ Gon, S et al. (2006) A novel regulatory mechanism couples deoxyribonucleotide synthesis and DNA replication in Escherichia coli. EMBO J. 25 1137-47 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).