dnaB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaB |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK4044, b4052, JW4012, groP, grpA, grpD[1], grpD |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
91.87 minutes |
MG1655: 4262337..4263752 |
||
|
NC_012967: 4243246..4244661 |
||||
|
NC_012759: 4201182..4202597 |
||||
|
W3110 |
|
W3110: 4267904..4269319 |
||
|
DH10B: 4362033..4363448 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4262340 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dnaB252(ts) |
temperature sensitive |
||||||
|
dnaB107(ts) |
temperature sensitive |
||||||
|
dnaB6(ts)(Am) |
Growth Phenotype |
lowered rate of DNA synthesis at 40C; when growing in rich broth medium at 30C there is a loss of viability |
experiments suggest that the strain's lethality can be uncoupled phenotypically from DNA synthesis cessation by treating cells after high temperature exposure | ||||
|
dnaB8(ts) |
temperature sensitive |
||||||
|
dnaB21 |
Growth Phenotype |
DNA synthesis is slowed at higher temperatures |
previously called 'FA21' | ||||
|
dnaB22(ts) |
temperature sensitive |
previously called 'FA22' | |||||
|
dnaB70(ts) |
temperature sensitive |
||||||
|
dnaB500(ts) |
temperature sensitive |
||||||
|
dnaB454(ts) |
temperature sensitive |
||||||
|
dnaB43(ts) |
temperature sensitive |
||||||
|
dnaB313(ts) |
temperature sensitive |
||||||
|
dnaB125(Am) |
amber (UAG) mutation | ||||||
|
dnaB1029 |
|||||||
|
dnaB1035 |
|||||||
|
dnaB1037 |
|||||||
|
dnaB1041 |
|||||||
|
dnaB1047 |
|||||||
|
dnaB1071 |
|||||||
|
dnaB1077 |
|||||||
|
dnaB1080 |
|||||||
|
dnaB1201 |
|||||||
|
dnaB1203 |
|||||||
|
dnaB1205 |
|||||||
|
dnaB1208 |
|||||||
|
dnaB1211 |
|||||||
|
dnaB1301 |
|||||||
|
dnaB1304 |
|||||||
|
dnaB306 |
|||||||
|
dnaB266 |
Growth Phenotype |
at 40C DNA synthesis stops but synthesis can be re-initiated by shifting back to permissive temperature |
previously called 'T266' | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4012 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAGGAAATAAACCCTTCAA Primer 2:CCTTCGTCGTCGTACTGCGGCCC | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 45% [15] | ||
|
Linked marker |
est. P1 cotransduction: 15% [15] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Nakayama, N et al. (1984) Nucleotide sequence of dnaB and the primary structure of the dnaB protein from Escherichia coli. J. Biol. Chem. 259 97-101 PubMed
- ↑ Sclafani, RA & Wechsler, JA (1981) Deoxyribonucleic acid initiation mutation dnaB252 is suppressed by elevated dnaC+ gene dosage. J. Bacteriol. 146 418-21 PubMed
- ↑ Zyskind, JW & Smith, DW (1977) NOVEL Escherichia coli dnaB mutant: direct involvement of the dnaB252 gene product in the synthesis of an origin-ribonucleic acid species during initiaion of a round of deoxyribonucleic acid replication. J. Bacteriol. 129 1476-86 PubMed
- ↑ 5.0 5.1 5.2 5.3 5.4 Saluja, D & Godson, GN (1995) Biochemical characterization of Escherichia coli temperature-sensitive dnaB mutants dnaB8, dnaB252, dnaB70, dnaB43, and dnaB454. J. Bacteriol. 177 1104-11 PubMed
- ↑ Carl, PL (1970) Escherichia coli mutants with temperature-sensitive synthesis of DNA. Mol. Gen. Genet. 109 107-22 PubMed
- ↑ 7.0 7.1 Fangman, WL & Novick, A (1968) Characterization of two bacterial mutants with temperature-sensitive synthesis of DNA. Genetics 60 1-17 PubMed
- ↑ Marinus, MG & Adelberg, EA (1970) Vegetative Replication and Transfer Replication of Deoxyribonucleic Acid in Temperature-Sensitive Mutants of Escherichia coli K-12. J. Bacteriol. 104 1266-72 PubMed
- ↑ Bonhoeffer, F (1966) DNA transfer and DNA synthesis during bacterial conjugation. Z. Vererbungsl. 98 141-9 PubMed
- ↑ Sclafani, RA & Wechsler, JA (1981) dnaB125, a dnaB nonsense mutation. J. Bacteriol. 146 1170-3 PubMed
- ↑ Worcel, A (1970) Induction of chromosome re-initiations in a thermosensitive DNA mutant of Escherichiacoli. J. Mol. Biol. 52 371-86 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 13.0 13.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 14.0 14.1 CGSC: The Coli Genetics Stock Center
- ↑ 15.0 15.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
