clpB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Standard name |
clpB |
---|---|
Mnemonic |
Caseinolytic protease |
Synonyms |
ECK2590, b2592, JW2573, htpM[1], htpM |
edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
---|---|---|---|---|
MG1655 |
58.83 minutes |
MG1655: 2732195..2729622 |
||
NC_012967: 2655581..2653008 |
||||
NC_012759: 2615434..2618007 |
||||
W3110 |
|
W3110: 2732829..2730256 |
||
DH10B: 2823960..2821387 |
||||
edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
---|---|---|---|---|---|
Coding Start (SO:0000323) |
2729622 |
Edman degradation |
| ||
edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
---|---|---|---|---|---|---|---|
clpBR819A |
R819A |
Loss of ability to form oligomers; loss of chaperone activity |
seeded from UniProt:P63284 | ||||
clpBE826A |
E826A |
No effect |
seeded from UniProt:P63284 | ||||
clpBGAR813AAA |
GAR813AAA |
No effect on oligomerization |
seeded from UniProt:P63284 | ||||
clpBR815A |
R815A |
Loss of ability to form oligomers; loss of chaperone activity |
seeded from UniProt:P63284 | ||||
clpBR756A |
R756A |
No effect on oligomerization. Loss of ATPase activity |
seeded from UniProt:P63284 | ||||
clpBD797A |
D797A |
No effect |
seeded from UniProt:P63284 | ||||
clpBE678A |
E678A |
No effect on oligomerization |
seeded from UniProt:P63284 | ||||
clpBK611T |
K611T |
No effect on ability to form oligomers. Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
clpBE257A |
E257A |
Decrease in ability to disaggregate proteins due to decreased substrate- binding activity. Retains hexameric quaternary structure and ATPase activity; when associated with A-254 |
seeded from UniProt:P63284 | ||||
clpBE279A |
E279A |
No effect on oligomerization |
seeded from UniProt:P63284 | ||||
clpBW543F |
W543F |
No effect on chaperone activity or ability to form oligomers |
seeded from UniProt:P63284 | ||||
clpBY251A |
Y251A |
Decrease in ability to disaggregate proteins due to decreased substrate- binding activity. Retains hexameric quaternary structure and ATPase activity |
seeded from UniProt:P63284 | ||||
clpBR332A |
R332A |
Loss of ability to form oligomers |
seeded from UniProt:P63284 | ||||
clpBE254A |
E254A |
Decrease in ability to disaggregate proteins due to decreased substrate- binding activity. Retains hexameric quaternary structure and ATPase activity; when associated with A-257 |
seeded from UniProt:P63284 | ||||
clpBK212T |
K212T |
Loss of ability to form oligomers even in the presence of ATP. Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
clpBE109A |
E109A |
Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
clpBL110Q |
L110Q |
30% decrease in chaperone activity; retains ATPase activity |
seeded from UniProt:P63284 | ||||
clpBS84A |
S84A |
No effect |
seeded from UniProt:P63284 | ||||
clpBL93Q |
L93Q |
Loss of chaperone activity. Retains ATPase activity |
seeded from UniProt:P63284 | ||||
clpBL97Q |
L97Q |
75% decrease in chaperone activity; retains ATPase activity |
seeded from UniProt:P63284 | ||||
clpBD103A |
D103A |
Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
clpBT7A |
T7A |
Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
ΔclpB (Keio:JW2573) |
deletion |
deletion |
|||||
clpB102(del-ins)::kan |
| ||||||
edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
---|---|---|---|---|---|---|
edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
Resource | Resource Type | Source | Notes/Reference |
---|---|---|---|
JW2573 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGTCTGGATCGTCTTACTAA Primer 2:CCtTGGACGGCGACAATCCGGTC | |
Kohara Phage |
|||
Linked marker |
est. P1 cotransduction: 48% [8] | ||
Linked marker |
est. P1 cotransduction: 77% [8] | ||
edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Database | Accession | Notes |
---|---|---|
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
edit table |
<protect></protect>
Notes
Links
Name | URL | Comments |
---|---|---|
edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Pontis, E et al. (1991) ClpB proteins copurify with the anaerobic Escherichia coli reductase. Biochem. Biophys. Res. Commun. 180 1222-6 PubMed
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Squires, CL et al. (1991) ClpB is the Escherichia coli heat shock protein F84.1. J. Bacteriol. 173 4254-62 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).