btuB:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
btuB |
|---|---|
| Mnemonic |
B12 uptake |
| Synonyms | |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
89.7 minutes |
MG1655: 4161662..4163506 |
||
|
NC_012967: 4143500..4145344 |
||||
|
NC_012759: 4051331..4053175 |
||||
|
W3110 |
|
W3110: 3473042..3471198 |
||
|
DH10B: 4261359..4263203 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4161722 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
btuB451 |
C to T |
L28P |
Inactivates uptake of cyanocobalamin |
seeded from UniProt:P06129 | |||
|
btuBV30G,P |
V30G,P |
Inactivates uptake |
seeded from UniProt:P06129 | ||||
|
btuB(del) (Keio:JW3938) |
deletion |
deletion |
|||||
|
btuB460::Tn10 |
|||||||
|
btuB51 |
|||||||
|
btuB501 |
|||||||
|
btuB69 |
|||||||
|
btuB451 |
C to T |
L28P |
Prevents uptake of cyanocobalamin |
||||
|
btuB3192::Tn10kan |
|||||||
|
btuB3191::Tn10 |
|||||||
|
btuB754(del)::kan |
|||||||
|
BtuB(del) |
Deletion |
Deletion |
Auxotrophies |
deletion causes uptake of Cbl to stop |
| ||
| edit table |
<protect></protect>
Notes
The Keio collection[6] lists a deletion of btuB. The insertion in this strain is a duplication of the btuB region.[9]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3938 |
Plasmid clone |
Status:Clone OK Primer 1:GCCATTAAAAAAGCTTCGCTGCT Primer 2:CCGAAGGTGTAGCTGCCAGACAA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 73% [12] | ||
|
Linked marker |
est. P1 cotransduction: 27% [12] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed
- ↑ 4.0 4.1 Bassford, PJ Jr & kadner, RJ (1977) Genetic analysis of components involved in vitamin B12 uptake in Escherichia coli. J. Bacteriol. 132 796-805 PubMed
- ↑ 5.0 5.1 Heller, K & Kadner, RJ (1985) Nucleotide sequence of the gene for the vitamin B12 receptor protein in the outer membrane of Escherichia coli. J. Bacteriol. 161 904-8 PubMed
- ↑ 6.0 6.1 6.2 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 7.0 7.1 7.2 CGSC: The Coli Genetics Stock Center
- ↑ Reynolds, PR et al. (1980) Transport of vitamin B12 in Escherichia coli. Some observations on the roles of the gene products of BtuC and TonB. J. Biol. Chem. 255 4313-9 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 11.0 11.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
