{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	blc
Gene Synonym(s)	ECK4145, b4149, JW4110, yjeL^[1], yjeL
Product Desc.	Blc outer membrane lipoprotein (lipocalin)^[2]^[3] Outer membrane lipoprotein, cell division and growth function; prokaryotic lipocalin^[4]
Product Synonyms(s)	outer membrane lipoprotein (lipocalin)^[1], B4149^[2]^[1], YjeL^[2]^[1], Blc^[2]^[1] , ECK4145, JW4110, yjeL, b4149
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): blc^[2]
Regulation/Activity
Quick Links
edit table

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]

RpoS regulon. AFMB Structural Genomics target No. 112 (http://afmb.cnrs-mrs.fr/article171.html). First 18 aa are a type II signal peptide.^[4]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	blc
Mnemonic	Bacterial lipocalin
Synonyms	ECK4145, b4149, JW4110, yjeL^[1], yjeL
edit table

Notes

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	94.3 minutes	MG1655: 4375745..4375212 <gbrowseImage> name=NC_000913:4375212..4375745 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4356433..4355897 <gbrowseImage> name=NC_012967:4355897..4356433 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4313947..4314480 <gbrowseImage> name=NC_012759:4313947..4314480 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4382402..4381869 <gbrowseImage> name=NC_007779:4381869..4382402 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4476107..4475574 <gbrowseImage> name=NC_010473:4475574..4476107 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Reference	Availability
Δblc (Keio:JW4110)	deletion	deletion	PMID:16738554	Shigen CGSC10959^[5]
Δblc-776::kan			PMID:16738554	CGSC:100206
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW4110	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCGCCTGCTCCCTCTCGTTGC Primer 2:CCACTACCAGGCTGCTGTACCCA
1D4	Kohara Phage	Genobase	PMID:3038334
3H6	Kohara Phage	Genobase	PMID:3038334
cadB2231::Tn10	Linked marker	CAG18488 = CGSC7479^[5]	est. P1 cotransduction: 51% ^[6] Synonyms:zjd-2231::Tn10
cycA30::Tn10	Linked marker	CAG12073 = CGSC7482^[5]	est. P1 cotransduction: 9% ^[6]
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:G7837	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12474	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120004333	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948670	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2367	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013590	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	Blc
Synonyms	outer membrane lipoprotein (lipocalin)^[1], B4149^[2]^[1], YjeL^[2]^[1], Blc^[2]^[1] , ECK4145, JW4110, yjeL, b4149
Product description	Blc outer membrane lipoprotein (lipocalin)^[2]^[3] Outer membrane lipoprotein, cell division and growth function; prokaryotic lipocalin^[4]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005215	transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002345	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005215	transporter activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002446	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002345	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006810	transport	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR002446	P	Seeded from EcoCyc (v14.0)	complete
	GO:0008289	lipid binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0446	F	Seeded from EcoCyc (v14.0)	complete
	GO:0009279	cell outer membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0998	C	Seeded from EcoCyc (v14.0)	complete
	GO:0016020	membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0472	C	Seeded from EcoCyc (v14.0)	complete
	GO:0031225	anchored to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9901	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006974	response to DNA damage stimulus	PMID:11967071^[7]	IEP: Inferred from Expression Pattern		P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	rpmG	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rplO	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	gapA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	gadB	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rplP	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	eno	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	groS	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rplF	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	ugpB	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rpsC	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rpmB	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	adhE	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rpsA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	hupA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	ahpC	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rplB	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	yfiD	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rpsJ	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rpsN	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rplA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	pflB	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	dps	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	rplY	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	secB	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	pgk	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	purA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	fbaA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	luxS	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	tig	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	cspA	PMID:19402753^[8]	LCMS(ID Probability):99.3
Protein	pykF	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	malE	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	yfcZ	PMID:19402753^[8]	LCMS(ID Probability):99.5
Protein	ptsH	PMID:19402753^[8]	LCMS(ID Probability):99.5
Protein	aspA	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	phoB	PMID:19402753^[8]	LCMS(ID Probability):99.0
Protein	fabD	PMID:19402753^[8]	LCMS(ID Probability):99.6
Protein	aceA	PMID:19402753^[8]	LCMS(ID Probability):99.6
edit table

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Evidence	Reference/Source
Outer membrane	PMID:15174130	EchoLocation:blc
outer membrane
edit table

Notes

Structure and Physical Properties

[back to top]

Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MRLLPLVAAA TAAFLVVACS SPTPPRGVTV VNNFDAKRYL GTWYEIARFD HRFERGLEKV TATYSLRDDG GLNVINKGYN PDRGMWQQSE GKAYFTGAPT RAALKVSFFG PFYGGYNVIA LDREYRHALV CGPDRDYLWI LSRTPTISDE VKQEMLAVAT REGFDVSKFI WVQQPGS
Length	177
Mol. Wt	19.851 kDa
pI	9.0 (calculated)
Extinction coefficient	35,410 - 35,660 (calc based on 9 Y, 4 W, and 2 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
motif	1-18	UniProt Manual:Signal Peptides	UniProt:P0A901
Domain	34..174	PF08212 Lipocalin-like domain		PMID:19920124^[9]
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=blc taxon=562,83333 </beststructure>

Models

View models at:

edit table

Structure figures

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131974	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948670	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013590	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A901	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:G7837	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12474	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948670	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120004333	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2367	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	E. coli K-12 MG1655	28	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	378	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	3^a	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	Low confidence in the sequencing data set.	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
blc
edit table

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<gbrowseImage> name=NC_000913:4375725..4375765 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b4149 (EcoliWiki Page)	NCBI GEO profiles for blc
microarray	GenExpDB:b4149 (EcoliWiki Page)	Summary of data for blc from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (4375208..4375456) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ09; Well:B5^[10]
edit table

Notes

Accessions Related to blc Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:G7837	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2367	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b4149
EcoGene	EcoGene:EG12474	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120004333	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013590	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Anopheles gambiae	ENSANGP00000029258 (score: 1.000; bootstrap: 100%) ENSANGP00000010586 (score: 0.139) ENSANGP00000028083 (score: 0.113)	From Inparanoid:20070104
Arabidopsis thaliana	AT5G58070 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Canis familiaris	ENSCAFP00000019702 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Danio rerio	ZDB-GENE-051023-8 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0190794 (score: 1.000; bootstrap: 100%) DDB0190641 (score: 0.531)	From Inparanoid:20070104
Drosophila melanogaster	FBgn0053126 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Gallus gallus	ENSGALP00000011312 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Homo sapiens	ENSP00000345179 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Monodelphis domestica	ENSMODP00000024719 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Mus musculus	MGI:88056 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Oryza gramene	Q6Z9F9 (score: 1.000; bootstrap: 100%) Q8S9H0 (score: 0.590) Q6K623 (score: 0.587)	From Inparanoid:20070104
Takifugu rubripes	NEWSINFRUP00000144341 (score: 1.000; bootstrap: 100%) NEWSINFRUP00000175177 (score: 0.547) NEWSINFRUP00000135728 (score: 0.286) NEWSINFRUP00000155674 (score: 0.209) NEWSINFRUP00000144340 (score: 0.132)	From Inparanoid:20070104
Tetraodon nigroviridis	GSTENP00016843001 (score: 1.000; bootstrap: 100%) GSTENP00025486001 (score: 0.212) GSTENP00010171001 (score: 0.134) GSTENP00037576001 (score: 0.113)	From Inparanoid:20070104
Shigella flexneri	BLC	From SHIGELLACYC
E. coli O157	BLC	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Superfamily (EcoliWiki Page)	SUPERFAMILY:50814
Panther (EcoliWiki Page)	PTHR10612:SF7
Pfam (EcoliWiki Page)	PF08212 Lipocalin-like domain
EcoCyc	EcoCyc:G7837	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG12474	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120004333	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB2367	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013590	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.00 ^1.01 ^1.02 ^1.03 ^1.04 ^1.05 ^1.06 ^1.07 ^1.08 ^1.09 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^3.0 ^3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^5.0 ^5.1 ^5.2 CGSC: The Coli Genetics Stock Center
↑ ^6.0 ^6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ Khil, PP & Camerini-Otero, RD (2002) Over 1000 genes are involved in the DNA damage response of Escherichia coli. Mol. Microbiol. 44 89-105 PubMed
↑ ^8.00 ^8.01 ^8.02 ^8.03 ^8.04 ^8.05 ^8.06 ^8.07 ^8.08 ^8.09 ^8.10 ^8.11 ^8.12 ^8.13 ^8.14 ^8.15 ^8.16 ^8.17 ^8.18 ^8.19 ^8.20 ^8.21 ^8.22 ^8.23 ^8.24 ^8.25 ^8.26 ^8.27 ^8.28 ^8.29 ^8.30 ^8.31 ^8.32 ^8.33 ^8.34 ^8.35 ^8.36 ^8.37 Hu, P et al. (2009) Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7 e96 PubMed
↑ Finn, RD et al. (2010) The Pfam protein families database. Nucleic Acids Res. 38 D211-22 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

blc:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to blc Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search