{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	basR
Gene Synonym(s)	ECK4106, b4113, JW4074, pmrA^[1], pmrA
Product Desc.	DNA-binding response regulator in two-component regulatory system with BasS^[1] Response regulator for Lipid A modification genes; two-component system involved in polymyxin resistance that senses high extracellular Fe(2+)^[2]
Product Synonyms(s)	PmrA^[3]^[1], B4113^[3]^[1], ECK4106, JW4074, pmrA, b4113
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): basRS^[3]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

[back to top]

BasS is the cognate sensor protein of the BasSR two-component system. Constitutive allele basR53 (pmrA53) confers polymyxin B resistance and deoxycholate hypersensitivity. EvgAS regulon. BasSR confers resistance to Fe(III)-mediated killing.The BasSR regulon has been primarily characterized in Salmonella; unlike E. coli, Salmonella also activates PmrAB(BasSR) in low Mg(2+), mediated by PhoPQ and the PmrD protein.^[2]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	basR
Mnemonic	Bacterial Adaptive reSponse
Synonyms	ECK4106, b4113, JW4074, pmrA^[1], pmrA
edit table

</protect>

Notes

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	93.35 minutes, 93.35 minutes	MG1655: 4331973..4331305 <gbrowseImage> name=NC_000913:4331305..4331973 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 4312664..4311996 <gbrowseImage> name=NC_012967:4311996..4312664 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 4270040..4270708 <gbrowseImage> name=NC_012759:4270040..4270708 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 4338628..4337960 <gbrowseImage> name=NC_007779:4337960..4338628 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 4432335..4431667 <gbrowseImage> name=NC_010473:4431667..4432335 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
basRS29G		S29G		(in strain: ECOR 1, ECOR 10, ECOR 11, ECOR 12, ECOR 13, ECOR 14, ECOR 15, ECOR 16, ECOR 17, ECOR 18, ECOR 19, ECOR 2, ECOR 20, ECOR 21, ECOR 22, ECOR 24, ECOR 25, ECOR 26, ECOR 27, ECOR 3, ECOR 30, ECOR 33, ECOR 34, ECOR 35, ECOR 36, ECOR 37, ECOR 38, ECOR 4, ECOR 40, ECOR 41, ECOR 42, ECOR 43, ECOR 44, ECOR 45, ECOR 46, ECOR 47, ECOR 48, ECOR 5, ECOR 50, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 6, ECOR 60, ECOR 61, ECOR 62, ECOR 63, ECOR 64, ECOR 65, ECOR 66, ECOR 67, ECOR 68, ECOR 69, ECOR 7, ECOR 70, ECOR 71, ECOR 72, ECOR 8 and ECOR 9)			Strain variation; seeded from UniProt:P30843
basRY214F		Y214F		(in strain: ECOR 27)			Strain variation; seeded from UniProt:P30843
basRI128N		I128N		(in strain: ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 62, ECOR 63 and ECOR 64)			Strain variation; seeded from UniProt:P30843
basRV129L		V129L		(in strain: ECOR 19)			Strain variation; seeded from UniProt:P30843
basRG144S		G144S		(in strain: ECOR 44, ECOR 48, ECOR 50, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 62, ECOR 63, ECOR 64 and ECOR 72)			Strain variation; seeded from UniProt:P30843
basRR207P		R207P		(in strain: ECOR 27)			Strain variation; seeded from UniProt:P30843
basRT31S		T31S		(in strain: ECOR 35, ECOR 36, ECOR 38, ECOR 40, ECOR 41, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 62, ECOR 63 and ECOR 64, ECOR 65 and ECOR 66)			Strain variation; seeded from UniProt:P30843
ΔbasR (Keio:JW4074)	deletion	deletion			PMID:16738554	Shigen CGSC10932^[4]
pmrA53	GGG to GTG	G53V	Resistant to	Polymixin B	PMID:16428424		Gain of function Strain DW137
pmrA53	GGG to GTG	G53V	Sensitivity to	Deoxycholate	PMID:16428424		Gain of function Strain DW137
ΔpmrA::cat	deletion:substitutino		Sensitivity to	Polymixin B	PMID:16428424
ΔbasR739::kan					PMID:16738554	CGSC:100154
pmrA in strain SC9252			Resistant to	Resistant to polymyxin	PMID:1656859	Strain: SC9252	table 1
pmrA in strain SC9252			Resistant to	Resistant to Gentamicin	PMID:1656859	Strain: SC9252	table 1
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW4074	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAAAATTCTGATTGTTGAAGA Primer 2:CCGTTTTCCTCATTCGCGACCAG
2C12	Kohara Phage	Genobase	PMID:3038334
8H1	Kohara Phage	Genobase	PMID:3038334
zje-2241::Tn10	Linked marker	CAG18427 = CGSC7481^[4]	est. P1 cotransduction: 38% ^[5]
cadB2231::Tn10	Linked marker	CAG18488 = CGSC7479^[4]	est. P1 cotransduction: 38% ^[5] Synonyms:zjd-2231::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11615	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11615	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001563	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:948631	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1572	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013466	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	BasR
Synonyms	PmrA^[3]^[1], B4113^[3]^[1], ECK4106, JW4074, pmrA, b4113
Product description	DNA-binding response regulator in two-component regulatory system with BasS^[1] Response regulator for Lipid A modification genes; two-component system involved in polymyxin resistance that senses high extracellular Fe(2+)^[2]
EC number (for enzymes)
edit table

Notes

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0000156	two-component response regulator activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001789	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000156	two-component response regulator activity	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001867	F	Seeded from EcoCyc (v14.0)	complete
	GO:0000160	two-component signal transduction system (phosphorelay)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001789	P	Seeded from EcoCyc (v14.0)	complete
	GO:0000160	two-component signal transduction system (phosphorelay)	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001867	P	Seeded from EcoCyc (v14.0)	complete
	GO:0000160	two-component signal transduction system (phosphorelay)	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0902	P	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001867	F	Seeded from EcoCyc (v14.0)	complete
	GO:0003677	DNA binding	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0238	F	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0963	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005737	cytoplasm	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-0086	C	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001789	P	Seeded from EcoCyc (v14.0)	complete
	GO:0006355	regulation of transcription, DNA-dependent	GOA:interpro GO_REF:0000002	IEA: Inferred from Electronic Annotation	InterPro:IPR001867	P	Seeded from EcoCyc (v14.0)	complete
	GO:0046677	response to antibiotic	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0046	P	Seeded from EcoCyc (v14.0)	complete
edit table

Interactions

See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	References	Evidence
Protein	ydgH	PMID:16606699	Experiment(s):EBI-1147473
Protein	rsuA	PMID:16606699	Experiment(s):EBI-1147473
Protein	prs	PMID:16606699	Experiment(s):EBI-1147473
Protein	srlR	PMID:16606699	Experiment(s):EBI-1147473
edit table

</protect>

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
cytoplasm			From EcoCyc^[6]
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MKILIVEDDT LLLQGLILAA QTEGYACDSV TTARMAEQSL EAGHYSLVVL DLGLPDEDGL HFLARIRQKK YTLPVLILTA RDTLTDKIAG LDVGADDYLV KPFALEELHA RIRALLRRHN NQGESELIVG NLTLNMGRRQ VWMGGEELIL TPKEYALLSR LMLKAGSPVH REILYNDIYN WDNEPSTNTL EVHIHNLRDK VGKARIRTVR GFGYMLVANE EN
Length	222
Mol. Wt	25.031 kDa
pI	5.9 (calculated)
Extinction coefficient	22,920 - 23,045 (calc based on 8 Y, 2 W, and 1 C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	References
Domain	145..216	PF00486 Transcriptional regulatory protein, C terminal	PMID:19920124
Domain	3..113	PF00072 Response regulator receiver domain	PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=basR taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:16131939	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:948631	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013466	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P30843	Escherichia coli str. K-12 substr. MG1655
EcoCyc	EcoCyc:EG11615	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11615	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:948631	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001563	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1572	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Notes	Reference(s)
Protein	Ecoli K-12	65.397+/-0.343	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		Single Molecule Fluorescence	PMID:20671182
mRNA	Ecoli K-12	0.020209581	Molecules/cell	Medium: Temperature (°C): Doubling time (min): Growth Rate(min): * Growth phase: other: *		by RNA_Seq	PMID:20671182
Protein	E. coli K-12 MG1655	663	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	542	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
Protein	E. coli K-12 MG1655	111	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling		PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
basRS
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:4331953..4331993 source=MG1655 flip=1 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b4113 (EcoliWiki Page)	NCBI GEO profiles for basR
microarray	GenExpDB:b4113 (EcoliWiki Page)	Summary of data for basR from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
edit table

Notes

Accessions Related to basR Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc	EcoCyc:EG11615	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1572	Escherichia coli str. K-12 substr. MG1655
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b4113
EcoGene	EcoGene:EG11615	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001563	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013466	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Arabidopsis thaliana	AT4G31920 (score: 1.000; bootstrap: 100%) AT2G01760 (score: 1.000; bootstrap: 100%) AT2G25180 (score: 0.521) AT3G16857 (score: 0.312) AT4G16110 (score: 0.186) AT5G49240 (score: 0.157) AT1G49190 (score: 0.149) AT3G62670 (score: 0.115) AT4G18020 (score: 0.115) AT5G07210 (score: 0.102) AT2G27070 (score: 0.098)	From Inparanoid:20070104
Dictyostelium discoideum	DDB0183884 (score: 1.000; bootstrap: 71%) DDB0191388 (score: 1.000; bootstrap: 62%) DDB0220512 (score: 0.106) DDB0231984 (score: 0.080) DDB0185194 (score: 0.077) DDB0187191 (score: 0.076) DDB0191306 (score: 0.075) DDB0204819 (score: 0.075) DDB0218392 (score: 0.066) DDB0218263 (score: 0.065) DDB0187593 (score: 0.065) DDB0185325 (score: 0.061) DDB0217795 (score: 0.060) DDB0220485 (score: 0.058) DDB0191407 (score: 0.058) DDB0188118 (score: 0.058) DDB0216671 (score: 0.056) DDB0206390 (score: 0.052)	From Inparanoid:20070104
Oryza gramene	Q6H805 (score: 1.000; bootstrap: 63%) Q94LW1 (score: 0.703) Q5SML5 (score: 0.284) Q6K8X6 (score: 0.277) Q67W50 (score: 0.231) Q948L2 (score: 0.203) Q7Y0W5 (score: 0.111) Q7Y0W3 (score: 0.111) Q7Y0W2 (score: 0.111) Q7Y0W4 (score: 0.108) Q6AU68 (score: 0.069) Q8H908 (score: 0.057)	From Inparanoid:20070104
Saccharomyces cerevisiae	YHR206W (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Schizosaccharomyces pombe	SPAC8C94 (score: 1.000; bootstrap: 100%)	From Inparanoid:20070104
Shigella flexneri	BASR	From SHIGELLACYC
E. coli O157	BASR	From ECOO157CYC
edit table

Do-It-Yourself Web Tools

Notes

Families

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF00486 Transcriptional regulatory protein, C terminal
Superfamily (EcoliWiki Page)	SUPERFAMILY:52172
Pfam (EcoliWiki Page)	PF00072 Response regulator receiver domain
EcoCyc	EcoCyc:EG11615	Escherichia coli str. K-12 substr. MG1655
EcoGene	EcoGene:EG11615	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:ECK120001563	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:EB1572	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:ABE-0013466	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 CGSC: The Coli Genetics Stock Center
↑ ^5.0 ^5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7

basR:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to basR Expression

Notes

Links

Evolution

Homologs in Other Organisms

Do-It-Yourself Web Tools

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search