basR:On One Page
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
| Standard Name |
basR |
|---|---|
| Gene Synonym(s) |
ECK4106, b4113, JW4074, pmrA[1], pmrA |
| Product Desc. |
DNA-binding response regulator in two-component regulatory system with BasS[1] Response regulator for Lipid A modification genes; two-component system involved in polymyxin resistance that senses high extracellular Fe(2+)[2] |
| Product Synonyms(s) | |
| Function from GO |
<GO_nr /> |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>
Notes
BasS is the cognate sensor protein of the BasSR two-component system. Constitutive allele basR53 (pmrA53) confers polymyxin B resistance and deoxycholate hypersensitivity. EvgAS regulon. BasSR confers resistance to Fe(III)-mediated killing.The BasSR regulon has been primarily characterized in Salmonella; unlike E. coli, Salmonella also activates PmrAB(BasSR) in low Mg(2+), mediated by PhoPQ and the PmrD protein.[2]
Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
basR |
|---|---|
| Mnemonic |
Bacterial Adaptive reSponse |
| Synonyms |
ECK4106, b4113, JW4074, pmrA[1], pmrA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
93.35 minutes, 93.35 minutes |
MG1655: 4331973..4331305 |
||
|
NC_012967: 4312664..4311996 |
||||
|
NC_012759: 4270040..4270708 |
||||
|
W3110 |
|
W3110: 4338628..4337960 |
||
|
DH10B: 4432335..4431667 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
basRS29G |
S29G |
(in strain: ECOR 1, ECOR 10, ECOR 11, ECOR 12, ECOR 13, ECOR 14, ECOR 15, ECOR 16, ECOR 17, ECOR 18, ECOR 19, ECOR 2, ECOR 20, ECOR 21, ECOR 22, ECOR 24, ECOR 25, ECOR 26, ECOR 27, ECOR 3, ECOR 30, ECOR 33, ECOR 34, ECOR 35, ECOR 36, ECOR 37, ECOR 38, ECOR 4, ECOR 40, ECOR 41, ECOR 42, ECOR 43, ECOR 44, ECOR 45, ECOR 46, ECOR 47, ECOR 48, ECOR 5, ECOR 50, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 6, ECOR 60, ECOR 61, ECOR 62, ECOR 63, ECOR 64, ECOR 65, ECOR 66, ECOR 67, ECOR 68, ECOR 69, ECOR 7, ECOR 70, ECOR 71, ECOR 72, ECOR 8 and ECOR 9) |
Strain variation; seeded from UniProt:P30843 | ||||
|
basRY214F |
Y214F |
(in strain: ECOR 27) |
Strain variation; seeded from UniProt:P30843 | ||||
|
basRI128N |
I128N |
(in strain: ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 62, ECOR 63 and ECOR 64) |
Strain variation; seeded from UniProt:P30843 | ||||
|
basRV129L |
V129L |
(in strain: ECOR 19) |
Strain variation; seeded from UniProt:P30843 | ||||
|
basRG144S |
G144S |
(in strain: ECOR 44, ECOR 48, ECOR 50, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 62, ECOR 63, ECOR 64 and ECOR 72) |
Strain variation; seeded from UniProt:P30843 | ||||
|
basRR207P |
R207P |
(in strain: ECOR 27) |
Strain variation; seeded from UniProt:P30843 | ||||
|
basRT31S |
T31S |
(in strain: ECOR 35, ECOR 36, ECOR 38, ECOR 40, ECOR 41, ECOR 51, ECOR 52, ECOR 53, ECOR 54, ECOR 55, ECOR 56, ECOR 57, ECOR 59, ECOR 60, ECOR 61, ECOR 62, ECOR 63 and ECOR 64, ECOR 65 and ECOR 66) |
Strain variation; seeded from UniProt:P30843 | ||||
|
ΔbasR (Keio:JW4074) |
deletion |
deletion |
PMID:16738554 |
||||
|
pmrA53 |
GGG to GTG |
G53V |
Resistant to |
Polymixin B |
PMID:16428424 |
Gain of function Strain DW137 | |
|
pmrA53 |
GGG to GTG |
G53V |
Sensitivity to |
Deoxycholate |
PMID:16428424 |
Gain of function Strain DW137 | |
|
ΔpmrA::cat |
deletion:substitutino |
Sensitivity to |
Polymixin B |
PMID:16428424 |
|||
|
ΔbasR739::kan |
PMID:16738554 |
||||||
|
pmrA in strain SC9252 |
Resistant to |
Resistant to polymyxin |
PMID:1656859 |
Strain: SC9252 |
table 1 | ||
|
pmrA in strain SC9252 |
Resistant to |
Resistant to Gentamicin |
PMID:1656859 |
Strain: SC9252 |
table 1 | ||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4074 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAAAATTCTGATTGTTGAAGA Primer 2:CCGTTTTCCTCATTCGCGACCAG | |
|
Kohara Phage |
PMID:3038334 | ||
|
Kohara Phage |
PMID:3038334 | ||
|
Linked marker |
est. P1 cotransduction: 38% [5] | ||
|
Linked marker |
est. P1 cotransduction: 38% [5] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001563 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EchoBASE:EB1572 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013466 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
BasR |
|---|---|
| Synonyms | |
| Product description |
DNA-binding response regulator in two-component regulatory system with BasS[1] Response regulator for Lipid A modification genes; two-component system involved in polymyxin resistance that senses high extracellular Fe(2+)[2] |
| EC number (for enzymes) |
|
| edit table |
<protect></protect>
Notes
Function
<protect>
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0000156 |
two-component response regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000156 |
two-component response regulator activity |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001867 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001867 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0000160 |
two-component signal transduction system (phosphorelay) |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0902 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001867 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0003677 |
DNA binding |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0238 |
F |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000023 |
IEA: Inferred from Electronic Annotation |
SP_SL:SL-0086 |
C |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001789 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0006355 |
regulation of transcription, DNA-dependent |
GOA:interpro |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001867 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
|
GO:0046677 |
response to antibiotic |
GOA:spkw |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0046 |
P |
Seeded from EcoCyc (v14.0) |
complete | |
| edit table |
Interactions
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
ydgH |
PMID:16606699 |
Experiment(s):EBI-1147473 | |
|
Protein |
rsuA |
PMID:16606699 |
Experiment(s):EBI-1147473 | |
|
Protein |
prs |
PMID:16606699 |
Experiment(s):EBI-1147473 | |
|
Protein |
srlR |
PMID:16606699 |
Experiment(s):EBI-1147473 | |
| edit table |
</protect>
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Reference/Source | Notes |
|---|---|---|---|---|
|
cytoplasm |
From EcoCyc[6] |
| ||
| edit table |
<protect></protect>
Notes
Structure and Physical Properties
<protect>
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Name | |
|---|---|
| Sequence |
MKILIVEDDT LLLQGLILAA QTEGYACDSV TTARMAEQSL EAGHYSLVVL DLGLPDEDGL HFLARIRQKK YTLPVLILTA RDTLTDKIAG LDVGADDYLV KPFALEELHA RIRALLRRHN NQGESELIVG NLTLNMGRRQ VWMGGEELIL TPKEYALLSR LMLKAGSPVH REILYNDIYN WDNEPSTNTL EVHIHNLRDK VGKARIRTVR GFGYMLVANE EN |
| Length |
222 |
| Mol. Wt |
25.031 kDa |
| pI |
5.9 (calculated) |
| Extinction coefficient |
22,920 - 23,045 (calc based on 8 Y, 2 W, and 1 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
<motif_map/> |
|
Structure
| </protect>
Structure figures<protect> | ||||||
Notes
Gene Product Resources
See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
ASAP:ABE-0013466 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
EcoCyc:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
RegulonDB:ECK120001563 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1572 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Value | Units | Experimental Conditions | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|
|
Protein |
Ecoli K-12 |
65.397+/-0.343 |
Molecules/cell |
|
Single Molecule Fluorescence |
PMID:20671182 | |
|
mRNA |
Ecoli K-12 |
0.020209581 |
Molecules/cell |
|
by RNA_Seq |
PMID:20671182 | |
|
Protein |
E. coli K-12 MG1655 |
663 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
542 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
|
Protein |
E. coli K-12 MG1655 |
111 |
molecules/cell/generation |
|
Ribosome Profiling |
PMID: 24766808 | |
| edit table |
Notes
Transcription and Transcriptional Regulation
<protect>
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
|
Figure courtesy of RegulonDB |
</protect>
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
<protect><gbrowseImage>
name=NC_000913:4331953..4331993
source=MG1655
flip=1
type=Gene+DNA_+Protein
preset=Nterminus
</gbrowseImage>
This picture shows the sequence around the N-terminus.
</protect>
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
</protect>
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
<protect>
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for basR | |
|
microarray |
Summary of data for basR from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
<protect></protect>
Notes
Accessions Related to basR Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1572 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001563 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013466 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;}
h2 .editsection { display:none;}</css>
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
BASR |
From SHIGELLACYC |
|
E. coli O157 |
BASR |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
<protect></protect>
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene:EG11615 |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB:ECK120001563 |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE:EB1572 |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP:ABE-0013466 |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
Categories


