{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

On One Page

Quickview |

Gene |

Product(s) |

Expression|

Evolution |

References |

Quickview

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Standard Name	bamE
Gene Synonym(s)	ECK2613, b2617, JW2598, smqA, bamE , smpA^[1]^[2], smpA
Product Desc.	BamE small membrane protein A^[3]^[4] Component of Outer Membrane Protein Assembly Complex^[4] Stabilizes BamABCD OM biogenesis complex; member of a BamABCDBamE multiprotein complex; probable lipoprotein, Cys conserved^[2]
Product Synonyms(s)	small membrane lipoprotein^[1], B2617^[3]^[1], SmqA^[3]^[1], BamE^[3]^[1], BamE ^[2] , ECK2613, JW2598, smpA, smqA, b2617
Function from GO	<GO_nr />
Knock-Out Phenotype
Regulation/Expression	transcription unit(s): bamE^[3]
Regulation/Activity
Quick Links
edit table

</protect> See Help:Quickview for help with entering information in the Quickview table. <protect></protect>

Notes

A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).

The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest ^[2].

[back to top]

smpA mutants are sensitive to rifampin, cholate, and SDS/EDTA, indicating an OM defect (Sklar, 2007). smpA bamB double mutant is non-viable (Sklar, 2007). SmpA is homologous to P. aeruginosa OmlA. First 19 aa are predicted to be a type II signal peptide.^[2]

Gene

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css> <protect>

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	bamE
Mnemonic
Synonyms	ECK2613, b2617, JW2598, smqA, bamE , smpA^[1]^[2], smpA
edit table

</protect>

Notes

A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).

The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest ^[2].

Location(s) and DNA Sequence

[back to top]

<protect> See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	59.31 minutes	MG1655: 2751627..2751968 <gbrowseImage> name=NC_000913:2751627..2751968 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2675089..2675241 <gbrowseImage> name=NC_012967:2675089..2675241 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2637439..2637780 <gbrowseImage> name=NC_012759:2637439..2637780 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2752261..2752602 <gbrowseImage> name=NC_007779:2752261..2752602 source=W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2843392..2843733 <gbrowseImage> name=NC_010473:2843392..2843733 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

</protect>

Notes

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
edit table

Notes

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔsmpA (Keio:JW2598)	deletion	deletion	Sensitivity to	0.5% SDS/1 mM EDTA, rifampicin, cholate ^[5].	PMID:16738554	Shigen CGSC10055^[6]
edit table

Notes

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

</protect>

Notes

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2598	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCCGCTGTAAAACGCTGACTGC Primer 2:CCGTTACCACTCAGCGCAGGTTT
E8F2	Kohara Phage	Genobase	PMID:3038334
22D7	Kohara Phage	Genobase	PMID:3038334
pheA18::Tn10	Linked marker	CAG12158 = CGSC7421^[6]	est. P1 cotransduction: 61% ^[7]
srlD3131::Tn10	Linked marker	CAG18642 = CGSC7423^[6]	est. P1 cotransduction: 1% ^[7] Synonyms:zfh-3131::Tn10, zfi-3131::Tn10
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2617
ECOL199310CYC (EcoliWiki Page)	ECOL199310CYC:C3139
ECOO157CYC (EcoliWiki Page)	ECOO157CYC:SMPA
EcoCyc (EcoliWiki Page)	ECOCYC:EG10952	Escherichia coli str. K-12 substr. MG1655
NCBI (EcoliWiki Page)	GeneID:945583	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Product(s)

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name	BamE
Synonyms	small membrane lipoprotein^[1], B2617^[3]^[1], SmqA^[3]^[1], BamE^[3]^[1], BamE ^[2] , ECK2613, JW2598, smpA, smqA, b2617
Product description	BamE small membrane protein A^[3]^[4] Component of Outer Membrane Protein Assembly Complex^[4] Stabilizes BamABCD OM biogenesis complex; member of a BamABCDBamE multiprotein complex; probable lipoprotein, Cys conserved^[2]
EC number (for enzymes)
edit table

Notes

BamA (SmpA) is non-essential ^[8]

Function

[back to top]

<protect> Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier	GO ID	GO term name	Reference	Evidence Code	with/from	Aspect	Notes	Status
	GO:0005886	plasma membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-1003	C	Seeded from EcoCyc (v14.0)	complete
	GO:0009279	cell outer membrane	GOA:spkw SP_KW:GO_REF:0000004	IEA: Inferred from Electronic Annotation	SP_KW:KW-0998	C	Seeded from EcoCyc (v14.0)	complete
	GO:0005515	protein binding	PMID:17404237	IPI: Inferred from Physical Interaction	EcoliWiki:yaeT	F		complete
	GO:0031225	anchored to membrane	GO_REF:0000023	IEA: Inferred from Electronic Annotation	SP_SL:SL-9901	C	Seeded from EcoCyc (v14.0)	complete
	GO:0045203	integral to cell outer membrane	PMID:17404237	IGI: Inferred from Genetic Interaction	EcoliWiki:yaeT	C		complete
	GO:0016020	membrane	PMID:17404237	IDA: Inferred from Direct Assay		C		complete
	GO:0043165	Gram-negative-bacterium-type cell outer membrane assembly	PMID:17404237	IGI: Inferred from Genetic Interaction	EcoliWiki:yaeT	P		complete
edit table

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type	Partner	Notes
Protein	BamA (yaeT)	BamE (SmpA) binds BamA via the BamCDE sub-complex (NlpB-YfiO-SmpA). Interactions between BamA-BamCDE are independent of the interaction between BamA-BamB (YfgL) ^[5]
Protein	BamC (nlpB)	BamE (SmpA) binds BamC as part of the BamCDE sub-complex (NlpB-YfiO-SmpA). ^[5]
Protein	BamD (yfiO)	BamE (SmpA) binds BamD as part of the BamCDE sub-complex (NlpB-YfiO-SmpA). ^[5]
edit table

</protect>

Notes

SmpA is a component of the YaeT complex, which is involved in assembling outer membrane proteins ^[8]

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment	Description	Evidence	Reference/Source	Notes
Outer membrane
edit table

Notes

Structure and Physical Properties

[back to top]

<protect> Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence	at EcoCyc MSDPFGTNTW FYVFRQQPGH EGVTQQTLTL TFNSSGVLTN IDNKPALSGN
Length	50
Mol. Wt	5.517 kDa
pI	5.6 (calculated)
Extinction coefficient	6,990 (calc based on 1 Y, 1 W, and C residues)
edit table

Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type	Residues	Description	Notes	References
motif	1-19	UniProt Manual:Signal Peptides	UniProt:P0A937
Domain	35..105	PF04355 SmpA / OmlA family		PMID:19920124
edit table

<motif_map/>

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

<beststructure> gene=smpA taxon=562,83333 </beststructure>

Models

View models at:

edit table

</protect>

Structure figures

</protect>

Notes

Gene Product Resources

[back to top]

See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type	Source	Notes/Reference
edit table

Notes

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
NCBI (Protein) (EcoliWiki Page)	GI:90111468	Escherichia coli str. K-12 substr. MG1655
NCBI (Protein) (EcoliWiki Page)	GeneID:945583	Escherichia coli str. K-12 substr. MG1655
UniProt (EcoliWiki Page)	UniProtKB/Swiss-Prot:P0A937	Escherichia coli str. K-12 substr. MG1655
NCBI (Gene) (EcoliWiki Page)	GeneID:945583	Escherichia coli str. K-12 substr. MG1655
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
EchoBASE	EchoBASE:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Expression

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Cellular Levels

[back to top]

See Help:Cellular levels

Molecule	Organism or Strain	Value	Units	Experimental Conditions	Assay used	Reference(s)
Protein	E. coli K-12 MC4100	1.04E+03	molecules/cell	Medium: median data from rich and minimal media Temperature (°C): 37 Doubling time (min): Growth Rate(min): Growth phase: other:	emPAI	PMID:18304323
Protein	E. coli K-12 MG1655	5689	molecules/cell/generation	Medium: MOPS Complete Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	1917	molecules/cell/generation	Medium: MOPS Minimal Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
Protein	E. coli K-12 MG1655	2862	molecules/cell/generation	Medium: MOPS Complete without Methionine Temperature (°C): 37 Doubling time (min): *Growth phase: OD: other:	Ribosome Profiling	PMID: 24766808
edit table

Notes

Transcription and Transcriptional Regulation

[back to top]

See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)
smpA
edit table

Figure courtesy of RegulonDB

</protect>

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]

<protect><gbrowseImage> name=NC_000913:2751607..2751647 source=MG1655 type=Gene+DNA_+Protein preset=Nterminus </gbrowseImage> This picture shows the sequence around the N-terminus.

</protect>

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

</protect>

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]

<protect> Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name	Mutation	Phenotype	Reference
edit table

Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type	Reference	Notes
microarray	GEO Profiles:b2617 (EcoliWiki Page)	NCBI GEO profiles for smpA
microarray	GenExpDB:b2617 (EcoliWiki Page)	Summary of data for smpA from multiple microarray studies
edit table

Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name	Resource Type	Description	Source	Notes
	GFP Fusion	Intergenic region (2751390..2751849) fused to gfpmut2.	OpenBioSystems	GFP fusion described in Zaslaver, et al. Plate:109-AZ17; Well:C5^[9]
edit table

Notes

Accessions Related to bamE Expression

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2617
RegulonDB	RegulonDB:	Escherichia coli str. K-12 substr. MG1655
ASAP	ASAP:	Escherichia coli str. K-12 substr. MG1655
edit table

Notes

Links

[back to top]

Name	URL	Comments
edit table

Evolution

[back to top]

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Homologs in Other Organisms

[back to top]

See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism	Homologs (Statistics)	Comments
Shigella flexneri	SMPA	From SHIGELLACYC
E. coli O157	SMPA	From ECOO157CYC
edit table

Notes

Families

[back to top]

<protect> See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database	Accession	Notes
Pfam (EcoliWiki Page)	PF04355 SmpA / OmlA family
edit table

</protect> <protect></protect>

Notes

Links

[back to top]

Name	URL	Comments
edit table

References

[back to top]

See Help:References for how to manage references in EcoliWiki.

↑ ^1.0 ^1.1 ^1.2 ^1.3 ^1.4 ^1.5 ^1.6 ^1.7 ^1.8 ^1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
↑ ^2.0 ^2.1 ^2.2 ^2.3 ^2.4 ^2.5 ^2.6 ^2.7 ^2.8 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 ^3.5 ^3.6 ^3.7 ^3.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^4.0 ^4.1 ^4.2 ^4.3 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
↑ ^5.0 ^5.1 ^5.2 ^5.3 Sklar, JG et al. (2007) Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104 6400-5 PubMed
↑ ^6.0 ^6.1 ^6.2 CGSC: The Coli Genetics Stock Center
↑ ^7.0 ^7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
↑ ^8.0 ^8.1 Sklar, JG et al. (2007) Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104 6400-5 PubMed
↑ Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed

bamE:On One Page

Quickview

Notes

Gene

Nomenclature

Notes

Location(s) and DNA Sequence

Notes

Sequence Features

Notes

Alleles and Phenotypes

Notes

Genetic Interactions

Notes

Genetic Resources

Notes

Accessions in Other Databases

Notes

Links

Product(s)

Nomenclature

Notes

Function

Notes

Localization

Notes

Structure and Physical Properties

Structure figures

Notes

Gene Product Resources

Notes

Accessions in Other Databases

Notes

Links

Expression

Overview

Cellular Levels

Notes

Transcription and Transcriptional Regulation

Notes

Translation and Regulation of Translation

Notes

Turnover and Regulation of Turnover

Notes

Experimental

Notes

Accessions Related to bamE Expression

Notes

Links

Evolution

Homologs in Other Organisms

Notes

Families

Notes

Links

References

Categories

Navigation menu

Search