ampC:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ampC |
|---|---|
| Mnemonic |
Ampicillin |
| Synonyms |
ECK4146, b4150, JW4111, ampA[1], ampA |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
94.31 minutes, 94.31 minutes |
MG1655: 4376967..4375834 |
||
|
NC_012967: 4357655..4356522 |
||||
|
NC_012759: 4314569..4315702 |
||||
|
W3110 |
|
W3110: 4383624..4382491 |
||
|
DH10B: 4477329..4476196 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4375837 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ampCS80D,E,G |
S80D,E,G |
Loss of activity |
seeded from UniProt:P00811 | ||||
|
ampCK83Q,T |
K83Q,T |
Lowers activity more than 1000- fold and increases protein stability |
seeded from UniProt:P00811 | ||||
|
ampCK331A |
K331A |
Lowers activity more than 1000- fold |
seeded from UniProt:P00811 | ||||
|
ampCN168D,H |
N168D,H |
Lowers activity more than 1000- fold |
seeded from UniProt:P00811 | ||||
|
ampCY166E |
Y166E |
Lowers activity more than 1000- fold |
seeded from UniProt:P00811 | ||||
|
ampC(del) (Keio:JW4111) |
deletion |
deletion |
|||||
|
ampC12 |
|||||||
|
ampC11 |
|||||||
|
ampC3 |
|||||||
|
ampC777(del)::kan |
|||||||
|
ampC |
Resistant to |
ampicillin resistance |
|||||
|
ampC |
Gene duplication in the ampC gene region |
Resistant to |
Ampicillin-hyperresistant mutants of Ecoli K12 with multiple gene duplications in the ampC gene region overproduced at least six proteins during anaerobic growth. All but two of the proteins were also overproduced during aerobic growth. |
||||
|
ampA1 |
Resistant to |
Resistant to Penicillins |
Referenced At: PMID:334718[7] & PMID:4904235[8] | ||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4111 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTCAAAACGACGCTCTGCGC Primer 2:CCtTGTAGAGCGTTAAGAATCTG | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 50% [11] | ||
|
Linked marker |
est. P1 cotransduction: 10% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Jaurin, B & Grundström, T (1981) ampC cephalosporinase of Escherichia coli K-12 has a different evolutionary origin from that of beta-lactamases of the penicillinase type. Proc. Natl. Acad. Sci. U.S.A. 78 4897-901 PubMed
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Eriksson-Grennberg, KR et al. (1971) Resistance of Escherichia coli to penicillins. IX. Genetics and physiology of class II ampicillin-resistant mutants that are galactose negative or sensitive to bacteriophage C21, or both. J. Bacteriol. 108 1210-23 PubMed
- ↑ 6.0 6.1 Cole, ST & Guest, JR (1979) Production of a soluble form of fumarate reductase by multiple gene duplication in Escherichia coli K12. Eur. J. Biochem. 102 65-71 PubMed
- ↑ Normark, S & Burman, LG (1977) Resistance of Escherichia coli to penicillins: fine-structure mapping and dominance of chromosomal beta-lactamase mutations. J. Bacteriol. 132 1-7 PubMed
- ↑ Held, WA & Smith, OH (1970) Mechanism of 3-methylanthranilic acid derepression of the tryptophan operon in Escherichia coli. J. Bacteriol. 101 209-17 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
