alaS:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
alaS |
|---|---|
| Mnemonic |
Alanine |
| Synonyms |
ECK2692, b2697, JW2667, act, ala-act, lovB, ala-a[1] |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
60.72 minutes |
MG1655: 2820033..2817403 |
||
|
NC_012967: 2716870..2714240 |
||||
|
NC_012759: 2703215..2705845 |
||||
|
W3110 |
|
W3110: 2820667..2818037 |
||
|
DH10B: 2912575..2909945 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
2817406 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔalaS (Keio:JW2667) |
deletion |
deletion |
Auxotrophies |
Strain contains duplication detected by PCR PMID:18652654[5] | |||
|
alaSE184Q |
E184Q |
Auxotrophies |
No inactivation |
seeded from UniProt:P00957 | |||
|
alaSD188N |
D188N |
Auxotrophies |
No inactivation |
seeded from UniProt:P00957 | |||
|
alaSH189Q |
H189Q |
Auxotrophies |
Inactivates the enzyme |
seeded from UniProt:P00957 | |||
|
alaSD191N |
D191N |
Auxotrophies |
No inactivation |
seeded from UniProt:P00957 | |||
|
alaSH192Q |
H192Q |
Auxotrophies |
Inactivates the enzyme |
seeded from UniProt:P00957 | |||
|
alaSC179S |
C179S |
Auxotrophies |
Inactivates the enzyme |
seeded from UniProt:P00957 | |||
|
alaSC182S |
C182S |
Auxotrophies |
No inactivation |
seeded from UniProt:P00957 | |||
|
alaS5(ts) |
Growth Phenotype |
temperature sensitive |
|||||
|
alaS4(ts) |
Growth Phenotype |
temperature sensitive |
|||||
|
alaS6(ts) |
Growth Phenotype |
temperature sensitive |
|||||
|
alaS3(ts) |
missense mutation |
Growth Phenotype |
temperature sensitive - no immediate cessation of protein synthesis but residual protein increases for long time, inclusion of 1% NaCl in medium permits colony formation above non-permissive temperature |
single-site mutation in structural gene of alanyl-tRNA synthetase | |||
|
ΔalaS772::kan |
deletion |
deletion |
Auxotrophies |
||||
|
alaS21 |
Resistant to |
Resistant to B lactam Mecillinam |
Strain: GC3702 |
See table 2 | |||
| edit table |
<protect></protect>
Notes
The Keio collection[3] lists a deletion of alaS. The insertion in this strain is a duplication of the alaS region.[8]
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2667 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCAAGAGCACCGCTGAGAT Primer 2:CCTTGCAATTTCGCGCTGACCCA | |
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: % [11] | ||
|
Linked marker |
est. P1 cotransduction: 76% [11] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Herlihy, WC et al. (1980) Mass spectra of partial protein hydrolysates as a multiple phase check for long polypeptides deduced from DNA sequences: NH2-terminal segment of alanine tRNA synthetase. Proc. Natl. Acad. Sci. U.S.A. 77 6531-5 PubMed
- ↑ 3.0 3.1 3.2 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Plaimas, K et al. (2008) Machine learning based analyses on metabolic networks supports high-throughput knockout screens. BMC Syst Biol 2 67 PubMed
- ↑ Buckel, P et al. (1976) Suppression of temperature-sensitive aminoacyl-tRNA synthetase mutations by ribosomal mutations: a possible mechanism. Mol. Gen. Genet. 149 51-61 PubMed
- ↑ Vinella, D et al. (1992) Penicillin binding protein 2 is dispensable in Escherichia coli when ppGpp synthesis is induced. EMBO J. 11 1493-501 PubMed
- ↑ Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).