thyA:Gene

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview

Gene

Gene Product(s)

Expression

Evolution

On One Page

Nomenclature

Location(s) and DNA Sequence

Alleles and Phenotypes

Genetic Resources

Accessions

Links

References

Suggestions

Nomenclature

[back to top]

Standard name	thyA
Mnemonic
Synonyms	ECK2823, b2827, JW2795
edit table

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Location(s) and DNA Sequence

[back to top]

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	63.85 minutes	MG1655: 2963177..2962383	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
W3110		W3110: 2963811..2963017	GBrowse(W3110)	FASTA Dump
edit table

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Sequence Features

[back to top]

Feature type	Location	Description
edit table

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Alleles and Phenotypes

[back to top]

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
ΔthyA (Keio:JW2795)	deletion	deletion			PMID:16738554	Shigen
thyA751						CGSC:4790
thyA25						CGSC:4870
thyA715						CGSC:5108
thyA36						CGSC:5214
thyA6						CGSC:5229
thyA47						CGSC:5247
thyA52						CGSC:5930
thyA12						CGSC:6324
thyA704						CGSC:6454
thyA3						CGSC:6456
thyA81						CGSC:6550
thyA82						CGSC:6553
thyA56						CGSC:6624
thyA117						CGSC:6693
thyA61						CGSC:6774
thyA144						CGSC:6965
thyA54						CGSC:6984
thyA42						CGSC:7046
thyA748::Tn10						CGSC:7146
thyA147						CGSC:7435
thyA148						CGSC:7441
thyA45						CGSC:7744
thyA702						CGSC:7782
thyA55						CGSC:8013
thyA43						CGSC:8047
thyA11						CGSC:8289
thyA24						CGSC:8317
thyA305						CGSC:8415
thyA14						CGSC:8453
thyA33						CGSC:8524
thyA114(Stable)::Mu						CGSC:8530
thyA20						CGSC:8680
thyA707						CGSC:8791
thyA111						CGSC:8970
thyA16						CGSC:9232
thyA15						CGSC:9246
thyA705						CGSC:9518
thyA48						CGSC:9636
thyA714						CGSC:9655
thyA95						CGSC:9679
thyA44						CGSC:9739
thyA710						CGSC:9829
thyA0						CGSC:9977
thyA299						CGSC:10047
thyA59						CGSC:10129
thyA746						CGSC:10313
ΔthyA752						CGSC:10675
thyA719						CGSC:10685
thyA755						CGSC:10854
thyA756						CGSC:10867
ΔthyA57						CGSC:10899
thyA758						CGSC:10937
thyA38						CGSC:11040
thyA26						CGSC:11309
thyA41						CGSC:11313
thyA23						CGSC:11395
thyA325						CGSC:11630
thyA46						CGSC:11771
thyA2						CGSC:13565
thyA18						CGSC:13591
thyA34						CGSC:13776
thyA10						CGSC:13932
thyA39						CGSC:13966
thyA29						CGSC:14002
thyA27						CGSC:14007
edit table

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Genetic Resources

[back to top]

Resource	Resource Type	Source	Notes/Reference
JW2795	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCAAACAGTATTTAGAACTGAT Primer 2:CCGATAGCCACCGGCGCTTTAAT
recD1901::Tn10	Linked marker	CAG12135 = CGSC7429	est. P1 cotransduction: 67%
speA210::Tn10	Linked marker	CAG12168 = CGSC7431	est. P1 cotransduction: % Synonyms:zgd-210::Tn10, zgf-210::Tn10
edit table

See Help:Gene_resources for help entering information into the Genetic Resources table.

Accessions in Other Databases

[back to top]

Database	Accession	Notes
EcoCyc (EcoliWiki Page)	EcoCyc:EG11002
EchoBASE (EcoliWiki Page)	EchoBASE:EB0995
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2827
ECOL199310CYC (EcoliWiki Page)	ECOL199310CYC:C3422
EcoGene (EcoliWiki Page)	EcoGene:EG11002
ECOO157CYC (EcoliWiki Page)	ECOO157CYC:THYA
CGSC (EcoliWiki Page)	CGSC:104
edit table

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Links

[back to top]

Name	URL	Comments
edit table

See Help:Links_table for how to enter or edit information in this section of EcoliWiki.

References

[back to top]

See Help:References for how to manage references in EcoliWiki.