trmD:Gene

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview

Gene

Gene Product(s)

Expression

Evolution

On One Page

Nomenclature

Location(s) and DNA Sequence

Sequence Features

Alleles and Phenotypes

Genetic Interactions

Genetic Resources

Accessions

Links

References

Suggestions

Nomenclature

[back to top]

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name	trmD
Mnemonic	tRNA methyltransferase
Synonyms	ECK2604, b2607, JW2588
edit table

Location(s) and DNA Sequence

[back to top]

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain	Map location	Genome coordinates	Genome browsers	Sequence links
MG1655	59.11 minutes, 59.11 minutes	MG1655: 2743361..2742594 <gbrowseImage> name=NC_000913:2742594..2743361 source=MG1655 preset=GeneLocation </gbrowseImage>	EcoCyc GBrowse(MG1655)	FASTA Dump EcoCyc Sequence Dump
REL606		NC_012967: 2666746..2665979 <gbrowseImage> name=NC_012967:2665979..2666746 source=REL606 preset=GeneLocation </gbrowseImage>	GBrowse (REL606)	FASTA Dump
BW2952		NC_012759: 2628406..2629173 <gbrowseImage> name=NC_012759:2628406..2629173 source=BW2952 preset=GeneLocation </gbrowseImage>	GBrowse (BW2952)	FASTA Dump
W3110		W3110: 2743995..2743228 <gbrowseImage> name=AC_000091:2743228..2743995 source=MG1655_W3110 preset=GeneLocation </gbrowseImage>	GBrowse(W3110)	FASTA Dump
DH10B		DH10B: 2835126..2834359 <gbrowseImage> name=NC_010473:2834359..2835126 source=DH10B preset=GeneLocation </gbrowseImage>	GBrowse(DH10B)	FASTA Dump
edit table

Sequence Features

[back to top]

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type	Strain	Genomic Location	Evidence	Reference	Notes
Coding Start (SO:0000323)	MG1655	2742594	Edman degradation	PMID:6337136
edit table

Alleles and Phenotypes

[back to top]

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele	Nt change(s)	AA change(s)	Phenotype: Type	Phenotype: Description	Reference	Availability	Comments
trmDD169A		D169A		Loss of activity			seeded from UniProt:P0A873
trmDL197A		L197A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDF171A		F171A		Loss of activity			seeded from UniProt:P0A873
trmDP184A		P184A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDG59A		G59A		Loss of activity			seeded from UniProt:P0A873
trmDG91A		G91A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDR114A		R114A		Loss of activity			seeded from UniProt:P0A873
trmDY115A		Y115A		Increases Km for S-adenosyl-L- methionine 24-fold			seeded from UniProt:P0A873
trmDG117A		G117A		Loss of activity			seeded from UniProt:P0A873
trmDD119A		D119A		Loss of activity			seeded from UniProt:P0A873
trmDR121A		R121A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDL196A		L196A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDV192A		V192A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDG141A		G141A		Increases Km for S-adenosyl-L- methionine 82-fold			seeded from UniProt:P0A873
trmDR154A		R154A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDD135A		D135A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDY136A		Y136A		Increases Km for S-adenosyl-L- methionine 68-fold			seeded from UniProt:P0A873
trmDP193A		P193A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDD128A		D128A		Loss of activity			seeded from UniProt:P0A873
trmDW207A		W207A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDW207F,H		W207F,H		Small decrease in activity			seeded from UniProt:P0A873
trmDR208A		R208A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
trmDI204A		I204A		Loss of activity; no effect on tRNA binding			seeded from UniProt:P0A873
edit table

Genetic Interactions

[back to top]

Interactor	Interaction	Allele	Score(s)	Reference(s)	Accessions	Notes
edit table

Genetic Resources

[back to top]

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource	Resource Type	Source	Notes/Reference
JW2588	Plasmid clone	Shigen	PMID:16769691 Status:Clone OK Primer 1:GCCTGGATTGGCATAATTAGCCT Primer 2:CCgGCCATCCCATCATGTTTATG
pheA18::Tn10	Linked marker	CAG12158 = CGSC7421	est. P1 cotransduction: 84%
srlD3131::Tn10	Linked marker	CAG18642 = CGSC7423	est. P1 cotransduction: % Synonyms:zfh-3131::Tn10, zfi-3131::Tn10
edit table

Accessions in Other Databases

[back to top]

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database	Accession	Notes
EcoCyc (EcoliWiki Page)	EcoCyc:EG11023
EchoBASE (EcoliWiki Page)	EchoBASE:EB1016
EcoliGenExpDB (EcoliWiki Page)	EcoliGenExpDB:b2607
ECOL199310CYC (EcoliWiki Page)	ECOL199310CYC:C3128
EcoGene (EcoliWiki Page)	EcoGene:EG11023
ECOO157CYC (EcoliWiki Page)	ECOO157CYC:TRMD
CGSC (EcoliWiki Page)	CGSC:76
ASAP (EcoliWikiPage)	ASAP:ABE-0008576
edit table

Links

[back to top]

Name	URL	Comments
edit table

<protect>

References

[back to top]

See Help:References for how to manage references in EcoliWiki.